SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g28670

Feature Type:gene_model
Chromosome:Gm13
Start:31663734
stop:31665547
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g28670
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G18660AT Annotation by Michelle Graham. TAIR10: NAD(P)-binding Rossmann-fold superfamily protein | chr5:6220872-6222125 REVERSE LENGTH=417 SoyBaseE_val: 0ISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0006636GO-bp Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process SoyBaseN/AISS
GO:0009073GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family biosynthetic process SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0016117GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0051744GO-mf Annotation by Michelle Graham. GO Molecular Function: 3,8-divinyl protochlorophyllide a 8-vinyl reductase activity SoyBaseN/AISS
KOG1203 KOG Predicted dehydrogenase JGI ISS
PTHR14194Panther NITROGEN METABOLIC REGULATION PROTEIN NMR-RELATED JGI ISS
PTHR14194:SF15Panther SUBFAMILY NOT NAMED JGI ISS
PF05368PFAM NmrA-like family JGI ISS
UniRef100_D7LYF5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Pale-green and chlorophyll B reduced 2 n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7LYF5_ARALL SoyBaseE_val: 0ISS
UniRef100_I1MF65UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MF65_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma13g28670
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g28670
ParalogEvidenceComments
Glyma15g10440 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g28670 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g215400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g28670
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g28670
>Glyma13g28670.1   sequence type=CDS   gene model=Glyma13g28670   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCCCTCTGCTACACTTCCAATTTCATCTCACTGAACCATAAAAAAAGCCTCTCCTTAACCTTCTCTTCAGAGTCTTCTCCTCACTTCATTAACCTATTTCCAGTTAAGCCTAAGAAACCTCACCACCCCATTAAGTTCACCGCAGAAAGGTTCAAACTTTTTGCCTCTCTGACGCCATCTCCACCAGTTGAGACCACCCCATCAAGTTATAGGTGCAAGAGCCCCAAAGATGTCAACGTCTTGGTGGTGGGTTCAACTGGGTACATTGGAAAGTTCGTGGTGAGAGAGTTGGTTAAGAGAGGATTTGATGTTACAGCCATTGCCAGAGAGAGGAGTGGGATTAAGGGCAGTGTTGATAAGGATCAGACTTTGAATCAGTTGAGAGGGGCCAATGTGTGTTTCTCAGATGTGACCAATTTGGATGCTTTTGAGGAATCTCTGAACAGTTTGGGGAAGTCATTTGATGTTGTGGTTTCATGTCTTGCTAGTAGAAATGGAGGTGTAAAGGACTCTTGGAAGATTGATTATGAGGCAACAAGGAATAGCCTTGTTGCTGGAAGAAAACGTGGTGCTTCACATTTTGTGCTGCTTTCAGCAATATGTGTGCAGAAGCCGCTCCTCGAGTTTCAGCGTGCCAAGTTGAAGTTTGAGGCTGAGTTGATGAAGTTAGCTGAGGAGGATGATGGATTCACTTATAGCATAGTGAGGCCAACTGCATTTTTCAAGAGTTTGGGGGGTCAGGTTGAGTTGGTGAAGGATGGGAAGCCTTATGTTATGTTTGGAGATGGGAAACTGTGTGCTTGTAAGCCTATGAGTGAGTCTGATCTGGCTTCTTTTATTGTGAATTGTGTGCTGAGTGAGGATAAGATTAACCAGGTGTTGCCAATTGGAGGGCCTGGGAAGGCATTGACTCCATTGGAACAAGGAGAGATGTTGTTTCGGCTTTTGGGGAAGGAGCCTAAGTTCTTGAAAGTTCCGATCGAAATAATGGATTTTGCCATTGGGGTTCTTGACTTTCTGGTTAAGGTCTTTCCTTCACTGGAAGATGCTGCTGAGTTTGGGAAGATTGGAAGATACTATGCAGCGGAAAGTATGTTGCTTCTGGATCCCGAGACTGGAGAGTACAGTGCTGAGAAGACACCTAGCTATGGTAATGATACATTGGAAGAGTTTTTTGCGAGGGTTCTCAGGGAGGGCATGGCTGGTCAGGAGCTAGGTGAGCAAACTATATTTTAA
Predicted protein sequences of Glyma13g28670
>Glyma13g28670.1   sequence type=predicted peptide   gene model=Glyma13g28670   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSLCYTSNFISLNHKKSLSLTFSSESSPHFINLFPVKPKKPHHPIKFTAERFKLFASLTPSPPVETTPSSYRCKSPKDVNVLVVGSTGYIGKFVVRELVKRGFDVTAIARERSGIKGSVDKDQTLNQLRGANVCFSDVTNLDAFEESLNSLGKSFDVVVSCLASRNGGVKDSWKIDYEATRNSLVAGRKRGASHFVLLSAICVQKPLLEFQRAKLKFEAELMKLAEEDDGFTYSIVRPTAFFKSLGGQVELVKDGKPYVMFGDGKLCACKPMSESDLASFIVNCVLSEDKINQVLPIGGPGKALTPLEQGEMLFRLLGKEPKFLKVPIEIMDFAIGVLDFLVKVFPSLEDAAEFGKIGRYYAAESMLLLDPETGEYSAEKTPSYGNDTLEEFFARVLREGMAGQELGEQTIF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo