|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT5G13490 | AT | Annotation by Michelle Graham. TAIR10: ADP/ATP carrier 2 | chr5:4336034-4337379 FORWARD LENGTH=385 | SoyBase | E_val: 7.00E-108 | ISS |
| GO:0006094 | GO-bp | Annotation by Michelle Graham. GO Biological Process: gluconeogenesis | SoyBase | N/A | ISS |
| GO:0006612 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane | SoyBase | N/A | ISS |
| GO:0006810 | GO-bp | Annotation by Michelle Graham. GO Biological Process: transport | SoyBase | N/A | ISS |
| GO:0006820 | GO-bp | Annotation by Michelle Graham. GO Biological Process: anion transport | SoyBase | N/A | ISS |
| GO:0006862 | GO-bp | Annotation by Michelle Graham. GO Biological Process: nucleotide transport | SoyBase | N/A | ISS |
| GO:0006865 | GO-bp | Annotation by Michelle Graham. GO Biological Process: amino acid transport | SoyBase | N/A | ISS |
| GO:0006888 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport | SoyBase | N/A | ISS |
| GO:0007010 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cytoskeleton organization | SoyBase | N/A | ISS |
| GO:0010363 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response | SoyBase | N/A | ISS |
| GO:0010498 | GO-bp | Annotation by Michelle Graham. GO Biological Process: proteasomal protein catabolic process | SoyBase | N/A | ISS |
| GO:0015696 | GO-bp | Annotation by Michelle Graham. GO Biological Process: ammonium transport | SoyBase | N/A | ISS |
| GO:0015802 | GO-bp | Annotation by Michelle Graham. GO Biological Process: basic amino acid transport | SoyBase | N/A | ISS |
| GO:0015865 | GO-bp | Annotation by Michelle Graham. GO Biological Process: purine nucleotide transport | SoyBase | N/A | ISS |
| GO:0043069 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death | SoyBase | N/A | ISS |
| GO:0043090 | GO-bp | Annotation by Michelle Graham. GO Biological Process: amino acid import | SoyBase | N/A | ISS |
| GO:0043269 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of ion transport | SoyBase | N/A | ISS |
| GO:0055085 | GO-bp | Annotation by Michelle Graham. GO Biological Process: transmembrane transport | SoyBase | N/A | ISS |
| GO:0005739 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion | SoyBase | N/A | ISS |
| GO:0005740 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial envelope | SoyBase | N/A | ISS |
| GO:0005743 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial inner membrane | SoyBase | N/A | ISS |
| GO:0005774 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane | SoyBase | N/A | ISS |
| GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
| GO:0009941 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope | SoyBase | N/A | ISS |
| GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
| GO:0005215 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: transporter activity | SoyBase | N/A | ISS |
| GO:0005471 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: ATP:ADP antiporter activity | SoyBase | N/A | ISS |
| GO:0005507 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: copper ion binding | SoyBase | N/A | ISS |
| GO:0005515 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein binding | SoyBase | N/A | ISS |
| KOG0749 | KOG | Mitochondrial ADP/ATP carrier proteins | JGI | ISS | |
| PTHR24089 | Panther | FAMILY NOT NAMED | JGI | ISS | |
| PTHR24089:SF35 | Panther | SUBFAMILY NOT NAMED | JGI | ISS | |
| PF00153 | PFAM | Mitochondrial carrier protein | JGI | ISS | |
| UniRef100_B4FSA7 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: ADP,ATP carrier protein n=1 Tax=Zea mays RepID=B4FSA7_MAIZE | SoyBase | E_val: 2.00E-114 | ISS |
| UniRef100_I1M0Y8 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1M0Y8_SOYBN | SoyBase | E_val: 0 | ISS |
|
Glyma13g27360 not represented in the dataset |
Glyma13g27360 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.13g203600 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma13g27360.1 sequence type=CDS gene model=Glyma13g27360 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high CTCTATGCTGAGGAAAAAAAAAACTTGCTTGCTCACTTTCCCATGTGTGCAATTTCAGCAGTTGTGTCCGTAACTGCTGCTGCCCCAATTGCACGCGTTAAACTCTTGATACAGAACCAGAATGAGATTATCAAAGTTGGTAGACTATATGAATCTTATAAGGGTATTGGAGATTGTTTTAAGAGAACAATTCAGGAGGAGGGTGTTTTTTCCCTGTGGAGAGGTAACACTGCAAGTGTCATCCGACATGTCCCTGCTCACGTCTTGAAGTTTCATTTGAACGGCTACTTCAATAGGCTTTTCAATTTCAACAAGGATAAGGATGGTTACTGGAAATGGTTTTTTGGCAACTTGGCCTCAGGAGGTGCTGCTGGTGCCTCATCCCTTTTGTTTATCTACTGCCTCGACTATGCCCGAACTGGTTTGGCTAATGATGTAAAGAAGGGTGGAGAAAGGCAATTCAATGGTCTTGTTGATGTTTACGGGAAGACATATGCATCTGATGGTATTGCTGGACTTTATCGTGGCTTCAACATTACTTGTGTTGGAGTCTTTGTGTACCGTGGTCTCTTCTTTGGATTGTATGATTCCCTGAGGCCAGCTCTCTTGGTTGGGAATTTTCAGGTGACATTTATTAGTTATTACATTGATGTTATTTTTATTCCTTTAAATTTGCGTCATTTTATTTTTGATCTTCTAGATTTGAAGTTGTATTTTTTATATAGTATCTATGCATGGTACACTATTAGAAGAAGAATGATGATGACATCTGGTGAAGCTGTGAAATACAAGAGCTCCATGGATGCATTTGCACAAATCCTCGAGAATGAGGGTGCCAAGTCCTTGTAG
>Glyma13g27360.1 sequence type=predicted peptide gene model=Glyma13g27360 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high LYAEEKKNLLAHFPMCAISAVVSVTAAAPIARVKLLIQNQNEIIKVGRLYESYKGIGDCFKRTIQEEGVFSLWRGNTASVIRHVPAHVLKFHLNGYFNRLFNFNKDKDGYWKWFFGNLASGGAAGASSLLFIYCLDYARTGLANDVKKGGERQFNGLVDVYGKTYASDGIAGLYRGFNITCVGVFVYRGLFFGLYDSLRPALLVGNFQVTFISYYIDVIFIPLNLRHFIFDLLDLKLYFLYSIYAWYTIRRRMMMTSGEAVKYKSSMDAFAQILENEGAKSL*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||