Glyma13g26630 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g26630): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g26630): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma13g26630

Feature Type:	gene_model
Chromosome:	Gm13
Start:	29802444
stop:	29804961
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma13g26630

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G27890	AT	Annotation by Michelle Graham. TAIR10: NADPH:quinone oxidoreductase \| chr3:10350807-10351938 REVERSE LENGTH=196	SoyBase	E_val: 3.00E-96	ISS
GO:0000165	GO-bp	Annotation by Michelle Graham. GO Biological Process: MAPK cascade	SoyBase	N/A	ISS
GO:0006096	GO-bp	Annotation by Michelle Graham. GO Biological Process: glycolysis	SoyBase	N/A	ISS
GO:0006612	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane	SoyBase	N/A	ISS
GO:0006833	GO-bp	Annotation by Michelle Graham. GO Biological Process: water transport	SoyBase	N/A	ISS
GO:0006970	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to osmotic stress	SoyBase	N/A	ISS
GO:0006972	GO-bp	Annotation by Michelle Graham. GO Biological Process: hyperosmotic response	SoyBase	N/A	ISS
GO:0007030	GO-bp	Annotation by Michelle Graham. GO Biological Process: Golgi organization	SoyBase	N/A	ISS
GO:0009266	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus	SoyBase	N/A	ISS
GO:0009595	GO-bp	Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0009697	GO-bp	Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process	SoyBase	N/A	ISS
GO:0009862	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009867	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0010167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to nitrate	SoyBase	N/A	ISS
GO:0010200	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to chitin	SoyBase	N/A	ISS
GO:0010310	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process	SoyBase	N/A	ISS
GO:0010363	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response	SoyBase	N/A	ISS
GO:0015706	GO-bp	Annotation by Michelle Graham. GO Biological Process: nitrate transport	SoyBase	N/A	ISS
GO:0016045	GO-bp	Annotation by Michelle Graham. GO Biological Process: detection of bacterium	SoyBase	N/A	ISS
GO:0031347	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of defense response	SoyBase	N/A	ISS
GO:0031348	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0043900	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0050776	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of immune response	SoyBase	N/A	ISS
GO:0050832	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0008752	GO-mf	Annotation by Michelle Graham. GO Molecular Function: FMN reductase activity	SoyBase	N/A	ISS
KOG4530	KOG	Predicted flavoprotein	JGI		ISS
PF03358	PFAM	NADPH-dependent FMN reductase	JGI		ISS
UniRef100_B7FMX0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: NADPH:quinone oxidoreductase n=1 Tax=Medicago truncatula RepID=B7FMX0_MEDTR	SoyBase	E_val: 6.00E-116	ISS
UniRef100_I1M0R6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M0R6_SOYBN	SoyBase	E_val: 6.00E-135	ISS

Expression Patterns of Glyma13g26630

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g26630 not represented in the dataset	Glyma13g26630 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g26630

Paralog	Evidence	Comments
Glyma15g37535	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g26630 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.13g196500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma13g26630

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Transcripts of Glyma13g26630

Limit To All Plant Sequences

>Glyma13g26630.2   sequence type=transcript   gene model=Glyma13g26630   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
AGACAGGTCACACACGTCTCTATTCTCAAGACTCTTTTTAAGGTAGCACTTGCACTCCACAAACTTATTGGAGCAGACAAGAACTTAAGTCTGTAGCCATGGCAATAGTAATCAAAGTGGCGGCTCTCTCTGGTTCCCTTAGAAAAGCTTCATACCACTCAGGCCTTATCCGAGCTGGTTCCATCTCTCTCAATTATCTTCATGTTTTGTTTTTAATTTTTGTTTCATCTTTGATATATGCTTAATTGCAAATTATTGTGGTGTTGTTGACTTTGGTGAGTGTTGGTGATGATGATGATCATGGTTGCAGCAATTGAACTGAGCAAAGGGGAAATTGAAGGAATTGAAATTGAGTTCATTGAAATTTCGGAGCTTCCCATGTTGAACACTGATCTTGAGATCAATGGGACCTACCCACCAATAGTTGAAGCTTTTCGTCAAAAGATTCTTCAAGCTGATAGTATTCTCTTTGCTTCTCCTGAATATAATTACTCTGTCACAGCTCTACTAAAGAATGCAATTGATTGGGCCTCTAGGCCCCCAAATGTTTGGGCTGGCAAAGCTGCTTCAATTGTAAGTGCCGGTGGGGACTTTGGTGGGGGAAGGTCACACTATCATCTTCGCCAAATTGGAGTGTACATTGATCTTCGTTTCATCAATAAACCAGAATTCTTCCTTCTTGCATTCAAACCACCACCAAAATTCAATGATGATGGTGACTTAATTGATGAAGAGGCCAAGGATAAGTTGAAGCAAGTTCTTCTGTCCTTGCGTGCATTTACTCTAAGACTTCAAGGCAAAAACTAAGCTTGAAGTTACTTTAATTCCACGAATTATTGTTGAAATAAGCTGAGGATTTAGAAATAAACCAATGTTATTCTGAACGTGAATGATGCCACTATGTATAAGGATGGTTTTTAAAGGTCGAAAATGTGTTAGTTCTCTACTTCTCTTGGTACATTTGGAGTAATGTTTGCATTTGTTGTCCTCTACTCTAATTCGGTTTTCTCACTCGTATCATATAGTTAGTTCTCTAGTACGCAATACTCTGACATTTTTGGTATATAAGGGCACGTGGTATCGTACTATGTAATAATGTTATGTGTGTTTCTTTATGTAAGAAATACTTATAGTAACTTTTTTCTTTAAATGTATAAAAAAATGTTAAGAACATTTTTTATAAGTCTATTAATAAAATATCATGAAAGCAAATGTCTTTATTGAATTC

Coding sequences of Glyma13g26630

Limit To All Plant Sequences

>Glyma13g26630.1   sequence type=CDS   gene model=Glyma13g26630   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAATAGTAATCAAAGTGGCGGCTCTCTCTGGTTCCCTTAGAAAAGCTTCATACCACTCAGGCCTTATCCGAGCTGCAATTGAACTGAGCAAAGGGGAAATTGAAGGAATTGAAATTGAGTTCATTGAAATTTCGGAGCTTCCCATGTTGAACACTGATCTTGAGATCAATGGGACCTACCCACCAATAGTTGAAGCTTTTCGTCAAAAGATTCTTCAAGCTGATAGTATTCTCTTTGCTTCTCCTGAATATAATTACTCTGTCACAGCTCTACTAAAGAATGCAATTGATTGGGCCTCTAGGCCCCCAAATGTTTGGGCTGGCAAAGCTGCTTCAATTGTAAGTGCCGGTGGGGACTTTGGTGGGGGAAGGTCACACTATCATCTTCGCCAAATTGGAGTGTACATTGATCTTCGTTTCATCAATAAACCAGAATTCTTCCTTCTTGCATTCAAACCACCACCAAAATTCAATGATGATGGTGACTTAATTGATGAAGAGGCCAAGGATAAGTTGAAGCAAGTTCTTCTGTCCTTGCGTGCATTTACTCTAAGACTTCAAGGCAAAAACTAA

>Glyma13g26630.2   sequence type=CDS   gene model=Glyma13g26630   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATGATGATCATGGTTGCAGCAATTGAACTGAGCAAAGGGGAAATTGAAGGAATTGAAATTGAGTTCATTGAAATTTCGGAGCTTCCCATGTTGAACACTGATCTTGAGATCAATGGGACCTACCCACCAATAGTTGAAGCTTTTCGTCAAAAGATTCTTCAAGCTGATAGTATTCTCTTTGCTTCTCCTGAATATAATTACTCTGTCACAGCTCTACTAAAGAATGCAATTGATTGGGCCTCTAGGCCCCCAAATGTTTGGGCTGGCAAAGCTGCTTCAATTGTAAGTGCCGGTGGGGACTTTGGTGGGGGAAGGTCACACTATCATCTTCGCCAAATTGGAGTGTACATTGATCTTCGTTTCATCAATAAACCAGAATTCTTCCTTCTTGCATTCAAACCACCACCAAAATTCAATGATGATGGTGACTTAATTGATGAAGAGGCCAAGGATAAGTTGAAGCAAGTTCTTCTGTCCTTGCGTGCATTTACTCTAAGACTTCAAGGCAAAAACTAA

Predicted protein sequences of Glyma13g26630

Limit To All Plant Sequences

>Glyma13g26630.1   sequence type=predicted peptide   gene model=Glyma13g26630   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAIVIKVAALSGSLRKASYHSGLIRAAIELSKGEIEGIEIEFIEISELPMLNTDLEINGTYPPIVEAFRQKILQADSILFASPEYNYSVTALLKNAIDWASRPPNVWAGKAASIVSAGGDFGGGRSHYHLRQIGVYIDLRFINKPEFFLLAFKPPPKFNDDGDLIDEEAKDKLKQVLLSLRAFTLRLQGKN*

>Glyma13g26630.2   sequence type=predicted peptide   gene model=Glyma13g26630   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MMMIMVAAIELSKGEIEGIEIEFIEISELPMLNTDLEINGTYPPIVEAFRQKILQADSILFASPEYNYSVTALLKNAIDWASRPPNVWAGKAASIVSAGGDFGGGRSHYHLRQIGVYIDLRFINKPEFFLLAFKPPPKFNDDGDLIDEEAKDKLKQVLLSLRAFTLRLQGKN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain