SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g24890

Feature Type:gene_model
Chromosome:Gm13
Start:28194492
stop:28195591
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g24890
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G05500AT Annotation by Michelle Graham. TAIR10: Rubber elongation factor protein (REF) | chr3:1593540-1594802 FORWARD LENGTH=246 SoyBaseE_val: 1.00E-25ISS
GO:0006865GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid transport SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
PF05755PFAM Rubber elongation factor protein (REF) JGI ISS
UniRef100_G7IPR9UniRef Annotation by Michelle Graham. Most informative UniRef hit: REF/SRPP-like protein n=1 Tax=Medicago truncatula RepID=G7IPR9_MEDTR SoyBaseE_val: 4.00E-28ISS
UniRef100_I1M0B6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1M0B6_SOYBN SoyBaseE_val: 5.00E-112ISS

Expression Patterns of Glyma13g24890
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g24890
ParalogEvidenceComments
Glyma07g31560 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g24890 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g180500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g24890
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g24890
>Glyma13g24890.1   sequence type=CDS   gene model=Glyma13g24890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGCAAGTTACCACCCTTAAATTCCTCATGCGTGGCGCCGCCACCGCCGCCGCTTGCACCAAGGAGCGCTCCGGCGTCCGGGCCGTCGAGGAAGCCGCCAAGAGTGCCATCGGCCCCGTCTACGACAAGTTCCACCTCGTTCCCGACGAGCTCGTCCGCATCGCCGACCGAAACTCCGATAGCTCCGTCGAGCACCGGCCTACCCCGCATCCCAGCTGTACAGCCGTCTCGGGCATCGCCGGAGCCGTTTACGCTAAGTGCGAGACGGTGGCGAAGGAGCTGTACGAGAGGTACGAGGCCAAGGCGGAGCAGTGCACTGTGGCAGTGCGGCGGAGACTGTTCCCTCAGGTGTCAAATGCGTCACATTGGACGGAGAAGTACAACGAGAAAGTTGCGGCGGCGGTGGAGAAGGGTCGTAGGGTTTCGGCATTGGTTGCTACGGAGAGGATATCTAAGATGTTTAGTGAGAAACGATCATGA
Predicted protein sequences of Glyma13g24890
>Glyma13g24890.1   sequence type=predicted peptide   gene model=Glyma13g24890   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVQVTTLKFLMRGAATAAACTKERSGVRAVEEAAKSAIGPVYDKFHLVPDELVRIADRNSDSSVEHRPTPHPSCTAVSGIAGAVYAKCETVAKELYERYEAKAEQCTVAVRRRLFPQVSNASHWTEKYNEKVAAAVEKGRRVSALVATERISKMFSEKRS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo