SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT4G18470 | AT | Annotation by Michelle Graham. TAIR10: negative regulator of systemic acquired resistance (SNI1) | chr4:10192984-10195511 FORWARD LENGTH=432 | SoyBase | E_val: 3.00E-96 | ISS |
| GO:0000085 | GO-bp | Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle | SoyBase | N/A | ISS |
| GO:0000724 | GO-bp | Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination | SoyBase | N/A | ISS |
| GO:0006260 | GO-bp | Annotation by Michelle Graham. GO Biological Process: DNA replication | SoyBase | N/A | ISS |
| GO:0006261 | GO-bp | Annotation by Michelle Graham. GO Biological Process: DNA-dependent DNA replication | SoyBase | N/A | ISS |
| GO:0006270 | GO-bp | Annotation by Michelle Graham. GO Biological Process: DNA replication initiation | SoyBase | N/A | ISS |
| GO:0006275 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of DNA replication | SoyBase | N/A | ISS |
| GO:0006306 | GO-bp | Annotation by Michelle Graham. GO Biological Process: DNA methylation | SoyBase | N/A | ISS |
| GO:0006342 | GO-bp | Annotation by Michelle Graham. GO Biological Process: chromatin silencing | SoyBase | N/A | ISS |
| GO:0006355 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent | SoyBase | N/A | ISS |
| GO:0007062 | GO-bp | Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion | SoyBase | N/A | ISS |
| GO:0007129 | GO-bp | Annotation by Michelle Graham. GO Biological Process: synapsis | SoyBase | N/A | ISS |
| GO:0007131 | GO-bp | Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination | SoyBase | N/A | ISS |
| GO:0007140 | GO-bp | Annotation by Michelle Graham. GO Biological Process: male meiosis | SoyBase | N/A | ISS |
| GO:0008283 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cell proliferation | SoyBase | N/A | ISS |
| GO:0009555 | GO-bp | Annotation by Michelle Graham. GO Biological Process: pollen development | SoyBase | N/A | ISS |
| GO:0009627 | GO-bp | Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance | SoyBase | N/A | ISS |
| GO:0009640 | GO-bp | Annotation by Michelle Graham. GO Biological Process: photomorphogenesis | SoyBase | N/A | ISS |
| GO:0009909 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of flower development | SoyBase | N/A | ISS |
| GO:0010113 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of systemic acquired resistance | SoyBase | N/A | ISS |
| GO:0010332 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to gamma radiation | SoyBase | N/A | ISS |
| GO:0016444 | GO-bp | Annotation by Michelle Graham. GO Biological Process: somatic cell DNA recombination | SoyBase | N/A | ISS |
| GO:0016567 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein ubiquitination | SoyBase | N/A | ISS |
| GO:0016570 | GO-bp | Annotation by Michelle Graham. GO Biological Process: histone modification | SoyBase | N/A | ISS |
| GO:0016571 | GO-bp | Annotation by Michelle Graham. GO Biological Process: histone methylation | SoyBase | N/A | ISS |
| GO:0016572 | GO-bp | Annotation by Michelle Graham. GO Biological Process: histone phosphorylation | SoyBase | N/A | ISS |
| GO:0016579 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein deubiquitination | SoyBase | N/A | ISS |
| GO:0022402 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cell cycle process | SoyBase | N/A | ISS |
| GO:0031047 | GO-bp | Annotation by Michelle Graham. GO Biological Process: gene silencing by RNA | SoyBase | N/A | ISS |
| GO:0032204 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of telomere maintenance | SoyBase | N/A | ISS |
| GO:0032504 | GO-bp | Annotation by Michelle Graham. GO Biological Process: multicellular organism reproduction | SoyBase | N/A | ISS |
| GO:0033044 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization | SoyBase | N/A | ISS |
| GO:0042138 | GO-bp | Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation | SoyBase | N/A | ISS |
| GO:0043247 | GO-bp | Annotation by Michelle Graham. GO Biological Process: telomere maintenance in response to DNA damage | SoyBase | N/A | ISS |
| GO:0043687 | GO-bp | Annotation by Michelle Graham. GO Biological Process: post-translational protein modification | SoyBase | N/A | ISS |
| GO:0045132 | GO-bp | Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation | SoyBase | N/A | ISS |
| GO:0045892 | GO-bp | Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent | SoyBase | N/A | ISS |
| GO:0045893 | GO-bp | Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent | SoyBase | N/A | ISS |
| GO:0048449 | GO-bp | Annotation by Michelle Graham. GO Biological Process: floral organ formation | SoyBase | N/A | ISS |
| GO:0051567 | GO-bp | Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation | SoyBase | N/A | ISS |
| GO:0051726 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle | SoyBase | N/A | ISS |
| GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
| GO:0044212 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: transcription regulatory region DNA binding | SoyBase | N/A | ISS |
| UniRef100_Q0ZFU8 | UniRef | Annotation by Michelle Graham. Best UniRef hit: SNI1 n=1 Tax=Glycine max RepID=Q0ZFU8_SOYBN | SoyBase | E_val: 0 | ISS |
| UniRef100_Q0ZFU8 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: SNI1 n=1 Tax=Glycine max RepID=Q0ZFU8_SOYBN | SoyBase | E_val: 0 | ISS |
|
Glyma13g24121 not represented in the dataset |
Glyma13g24121 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma07g32461 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.13g172400 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma13g24121.1 sequence type=CDS gene model=Glyma13g24121 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGAGAACCCTAGCAGTGGTGAAAGATGGAGCAGAGCAGGAATCGATGACAACATGCTGGCTATGTTTGATGCCTCCGAAACCAAGGATGTTCATCAAGATGCCCTAGATGACCGGATTGCTTTTATTGATGCTGTTCGTGCTTCTTGTGAACATGGAAAACCGCCCACTTCAAAGATTTTTGGGGCAGTTTTCCACATGCTGAGGACAGGGAAGTCTCTAGAGTTGATTGTGGGAAGTTATAAGCTTCTGGTTGATTTAGACAAGCACTTCCCTCGTGTGTATTTATCTGGCATGGATGATTCCCGATCATCATCTAACTCTCCATCAAAATTGGTTGTGGTTAAAGAGGCATGGGCTCCCATTATTGGTTTCGTGGATAAGGCCACTGCTGTTAGTGAAGCCGGTGACAAACAGTCTGGTGGATCTCTTGACCACTCTAGCTTTCAAGCTCTGATTGAAGAGCTGGCTGAAATTTTATCTGAGACCAAATTTGAAGCAGCAAGCATGGAGCCCTTGAGGAACATGTTAATCTTTCAGTACCTTGTCGTTGTTTTTGAGGATGATTTTCTACCTCGCAACGCAACCTTGAACTGGAGCATGCAGAGGGAGTCTTTGCTCAGCCTGCTACTGGGATCTAGGAAAATAAATTACAAAAGCTTGATGAAGTATTTCATGGCAATTCTGTGTCAACTATCTCAACTTCAAAGTGAACTCAGTAAACATCCAGTGCTTCAAGAAAGTTCTGAATCTAAGTTATCCAAAAATTGTCATACTGCACTATCTCTTGCTTTACATGGAGTATTAAAGGACACATGTGTCTCAATGGAGAAACTTCTAGTGATGATTATGGACCTTGATATGGCAAGGAAGATAGCAGATATTGAAGGTCACACTACAAGAGGAGACAGTCCAAGAACACCTTTGATGGACATAATTCTGGATGAACTCTCTTACAACAAAGATAGTGTCCCTGTTTTTCTTAAGATCTTCAGTGAATCTAAATGGAAGCTAGAAATAGTTGTGCAGTATCTGTGGAAATACATAACCAAGCCTTCTGTTCGTACCCGCAAGTCAAATGGTCATACTGAGGATGCAACATTTGATGGGGCTTTGAAGTGCTTTTCAAATAAAACTGGCACTAAGAGCTTAATAAAAAAAATTGGTGTAGATGTAGTTCAATTCCTTCTGGCTCATGGTTTTCAGGCTCACTTGTCAATATTGTCAAAAGGAAATGCTGGTGATAAACAAGGGGGAGACAGTGCTATTGTGGATTCGTGTCAGACTTTTATCTCTGCTTTTGATAGTTTGAGAAGCACAGATGCGCAAATGGAGATATTGTCTATAGGAAAAGAGGCACTATTTACTGCGGCAACTATTATCTTCATGAAATCATAG
>Glyma13g24121.1 sequence type=predicted peptide gene model=Glyma13g24121 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MENPSSGERWSRAGIDDNMLAMFDASETKDVHQDALDDRIAFIDAVRASCEHGKPPTSKIFGAVFHMLRTGKSLELIVGSYKLLVDLDKHFPRVYLSGMDDSRSSSNSPSKLVVVKEAWAPIIGFVDKATAVSEAGDKQSGGSLDHSSFQALIEELAEILSETKFEAASMEPLRNMLIFQYLVVVFEDDFLPRNATLNWSMQRESLLSLLLGSRKINYKSLMKYFMAILCQLSQLQSELSKHPVLQESSESKLSKNCHTALSLALHGVLKDTCVSMEKLLVMIMDLDMARKIADIEGHTTRGDSPRTPLMDIILDELSYNKDSVPVFLKIFSESKWKLEIVVQYLWKYITKPSVRTRKSNGHTEDATFDGALKCFSNKTGTKSLIKKIGVDVVQFLLAHGFQAHLSILSKGNAGDKQGGDSAIVDSCQTFISAFDSLRSTDAQMEILSIGKEALFTAATIIFMKS*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
