SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g24060

Feature Type:gene_model
Chromosome:Gm13
Start:27394565
stop:27398455
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g24060
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G28960AT Annotation by Michelle Graham. TAIR10: nudix hydrolase homolog 15 | chr1:10110135-10111607 REVERSE LENGTH=293 SoyBaseE_val: 2.00E-134ISS
GO:0006104GO-bp Annotation by Michelle Graham. GO Biological Process: succinyl-CoA metabolic process SoyBaseN/AISS
GO:0006753GO-bp Annotation by Michelle Graham. GO Biological Process: nucleoside phosphate metabolic process SoyBaseN/AISS
GO:0006914GO-bp Annotation by Michelle Graham. GO Biological Process: autophagy SoyBaseN/AISS
GO:0015937GO-bp Annotation by Michelle Graham. GO Biological Process: coenzyme A biosynthetic process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0008893GO-mf Annotation by Michelle Graham. GO Molecular Function: guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity SoyBaseN/AISS
GO:0010945GO-mf Annotation by Michelle Graham. GO Molecular Function: CoA pyrophosphatase activity SoyBaseN/AISS
GO:0016787GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity SoyBaseN/AISS
KOG3069 KOG Peroxisomal NUDIX hydrolase JGI ISS
PTHR12992Panther MUTT-NUDIX-RELATED JGI ISS
PF00293PFAM NUDIX domain JGI ISS
UniRef100_D7KCZ0UniRef Annotation by Michelle Graham. Most informative UniRef hit: F1K23.5 n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7KCZ0_ARALL SoyBaseE_val: 4.00E-132ISS
UniRef100_I1M039UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M039_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma13g24060
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g24060
ParalogEvidenceComments
Glyma07g32540 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g24060 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g171900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g24060
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g24060
>Glyma13g24060.1   sequence type=CDS   gene model=Glyma13g24060   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATTTCCATTCTGAGAACATTACCAACGACAAGATCCTTATTACCGAGAGCATCTTCTTCCATCACCAAATTCATGGATTCTTCCTCCAACGCCAGCAGCATTGGAGGATCTCAGAGGCTCTTTGCGTTAGCACAGCACCTTCGCCAGTACAAGGCACCGTCTTTCCCCGAAGATATTGTGGAACAAAGCATTGAAGAGATTGGTGGCAAGGTTGTTTCTCAGGTGGGATTTCAAGAATCAGCCATCCCAATTGGCCAAAACCCTGAGAAATTCAGACCCAAAAAAGCTGCTGTTTTGATCTGCCTATTCGAAGGGGATGATGGGGATCTAAGGGTCATTCTCACCAAGCGCTCTTCCAAGCTTTCTACTCACTCGGGTGAAGTGGCATTGCCTGGTGGGAAAACTGAGGAGGGGGATAAGGATGATGGGGATACTGCAAAAAGAGAGGCAAAGGAAGAAATTGGGTTGGACCCGGAACTTGTCAATGTTGTTACTGTACTTGAACCATTCTTGTCTAAGCACCTCCTAAGGGTAGTTCCAGTCATTGGCATACTTCATGACAAGAAAGCATTCAAACCTGTTCTGAATCCAGCTGAAGTGGAAGCAGTATTTGATGCACCTTTGGAAATGTTTCTCAAGGATGAAAATCGGAGACAGGATGAGAGGGAGTGGATGGGAGAGAAGTATTTGTTGCATTTCTTTGACTATGATATCGGGCATAAAAAATACATCATATGGGGTTTAACTGCTGGGATCTTGATTAGGGCTGCATCAGTTGTGTACCAACGGCAGCCAGCTTTTGTGGAGCAGAACCCTAAATTCAAGCTTCCACAGGATGTATCCAAGGACACTACAATACCTTGA
Predicted protein sequences of Glyma13g24060
>Glyma13g24060.1   sequence type=predicted peptide   gene model=Glyma13g24060   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MISILRTLPTTRSLLPRASSSITKFMDSSSNASSIGGSQRLFALAQHLRQYKAPSFPEDIVEQSIEEIGGKVVSQVGFQESAIPIGQNPEKFRPKKAAVLICLFEGDDGDLRVILTKRSSKLSTHSGEVALPGGKTEEGDKDDGDTAKREAKEEIGLDPELVNVVTVLEPFLSKHLLRVVPVIGILHDKKAFKPVLNPAEVEAVFDAPLEMFLKDENRRQDEREWMGEKYLLHFFDYDIGHKKYIIWGLTAGILIRAASVVYQRQPAFVEQNPKFKLPQDVSKDTTIP*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo