Report for Sequence Feature Glyma13g22620
Feature Type: gene_model
Chromosome: Gm13
Start: 26101707
stop: 26105921
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma13g22620
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G26580 AT
Annotation by Michelle Graham. TAIR10: plant-specific transcription factor YABBY family protein | chr2:11303923-11306739 REVERSE LENGTH=164
SoyBase E_val: 1.00E-89 ISS
GO:0006333 GO-bp
Annotation by Michelle Graham. GO Biological Process: chromatin assembly or disassembly
SoyBase N/A ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0006417 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of translation
SoyBase N/A ISS
GO:0009657 GO-bp
Annotation by Michelle Graham. GO Biological Process: plastid organization
SoyBase N/A ISS
GO:0009965 GO-bp
Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis
SoyBase N/A ISS
GO:0030154 GO-bp
Annotation by Michelle Graham. GO Biological Process: cell differentiation
SoyBase N/A ISS
GO:0045893 GO-bp
Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003700 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity
SoyBase N/A ISS
PF04690 PFAM
YABBY protein
JGI ISS
UniRef100_G7JE42 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: YABBY protein n=1 Tax=Medicago truncatula RepID=G7JE42_MEDTR
SoyBase E_val: 3.00E-121 ISS
UniRef100_I1LZN8 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LZN8_SOYBN
SoyBase E_val: 1.00E-136 ISS
Expression Patterns of Glyma13g22620
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma13g22620
Paralog Evidence Comments
Glyma17g12200 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma13g22620 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.13g157800 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma13g22620
Coding sequences of Glyma13g22620
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma13g22620.1 sequence type=CDS gene model=Glyma13g22620 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGTCGAGCTGCAGCATCGATGTTGCGCCTGAGCAACTCTGCTACATCCCCTGCAACTTCTGCAATATTGTTCTTGCGGTGAGTGTTCCATGCAGTAGCCTGTTTGACATTGTGACCGTTCGATGTGGGCACTGCACCAATCTATGGTCCGTGAACATGGCCGCCGCGTTTCAGTCACTGTCATGGCAAGATGTTCAGGGATCTGGGCACTGCAATCCAGAGTACAGGATTGACACTGGCTCCACGTCCAAATGCAACAATAGGATTGCAATGCGTGCGCCCACCACTCATGTAACTGAGGAAAGGGTTGTGAACAGGCCTCCCGAGAAGAGGCAGCGCGTACCTTCTGCTTATAACCAGTTTATAAAGGAAGAGATTCAGAGGATCAAAGCCAATAATCCTGATATCAGTCATAGAGAAGCTTTCAGTACAGCTGCAAAGAACTGGGCACATTTTCCCCATATTCATTTCGGGCTGATGTTGGAGAGCAACAACCAAGTTAAGATGGAGAATGTTTCTGAGAAGCATTTAATGTCAAGGGCTGCGCTATTGAATAAATGA
Predicted protein sequences of Glyma13g22620
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma13g22620.1 sequence type=predicted peptide gene model=Glyma13g22620 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MSSCSIDVAPEQLCYIPCNFCNIVLAVSVPCSSLFDIVTVRCGHCTNLWSVNMAAAFQSLSWQDVQGSGHCNPEYRIDTGSTSKCNNRIAMRAPTTHVTEERVVNRPPEKRQRVPSAYNQFIKEEIQRIKANNPDISHREAFSTAAKNWAHFPHIHFGLMLESNNQVKMENVSEKHLMSRAALLNK*