SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g22220): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g22220): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma13g22220

Feature Type:gene_model
Chromosome:Gm13
Start:25806881
stop:25815610
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G03910AT Annotation by Michelle Graham. TAIR10: ABC2 homolog 12 | chr5:1054313-1057105 REVERSE LENGTH=634 SoyBaseE_val: 6.00E-31ISS
GO:0006200GO-bp Annotation by Michelle Graham. GO Biological Process: ATP catabolic process SoyBaseN/AISS
GO:0006810GO-bp Annotation by Michelle Graham. GO Biological Process: transport SoyBaseN/AISS
GO:0010315GO-bp Annotation by Michelle Graham. GO Biological Process: auxin efflux SoyBaseN/AISS
GO:0010540GO-bp Annotation by Michelle Graham. GO Biological Process: basipetal auxin transport SoyBaseN/AISS
GO:0010541GO-bp Annotation by Michelle Graham. GO Biological Process: acropetal auxin transport SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0005215GO-mf Annotation by Michelle Graham. GO Molecular Function: transporter activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016887GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity SoyBaseN/AISS
GO:0017111GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity SoyBaseN/AISS
GO:0042626GO-mf Annotation by Michelle Graham. GO Molecular Function: ATPase activity, coupled to transmembrane movement of substances SoyBaseN/AISS
PTHR24221Panther FAMILY NOT NAMED JGI ISS
PTHR24221:SF84Panther JGI ISS
UniRef100_B9SWF7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Abc transporter, putative n=1 Tax=Ricinus communis RepID=B9SWF7_RICCO SoyBaseE_val: 3.00E-34ISS
UniRef100_UPI000233D0EFUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233D0EF related cluster n=1 Tax=unknown RepID=UPI000233D0EF SoyBaseE_val: 4.00E-56ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g22220 not represented in the dataset

Glyma13g22220 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma10g08560 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma13g22220.1   sequence type=CDS   gene model=Glyma13g22220   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CACAAGCCCATCCTCTGCCGCTGGCTCTGCAGCGCCCTCTCCATCTACTCCCTCTCCGTCCTCCTCTCCAAGCTCCCCACAATCGCCACCCGCCTCCATCGACGCCGCCCCCTCCTCGTCACGCGCCTCGCCGCCGGCTACGCGCAGCACGCGCTCCTCTGGGAGGCCGCGCTCGGCGCCGTCTACGATCTCCGGCTCCACTTCTTCGAAGGCGTGTCCGCTGGCGACGTGGCGTACCGAATCACCGCCGAAGCCTCCGACCTCGCCGTTACCCTGTACACTCTTCTTAACCAAAATGGAGGTCTGACTATAGTACCAAGTACTCTGCAGTTGTCGGCAATGATGATGCAGATGTTAGTCTTATACCCTTTCTTTGATTTCAGCCATGATTGTTCCTTGCATGGTGCTAGTTTTGCCTTTCTTGGTCAAGAACTTCGCAAGATATCCAAAGAGGCACATGTTAGCATTGCTGCTCTCTCAGCTTATCTAAATGAACCTGGAGAGACAGTTGCTATTGTGGGTCCTTCTGGTGGAGGTTGTATACTGATTGATAACCATAACATCCAAAACATTCGGTTGGCAAGTTTGAGAAGACATGTGCTTGTGATTTCCTATCGCTTGGAAACAGTTATGATGGCTAAACGAGTATTCCTTTTGGACGATGGGAAGCTAAAAGAGCTGCCTCAATCAACTATGTTGGAT

>Glyma13g22220.1   sequence type=predicted peptide   gene model=Glyma13g22220   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
HKPILCRWLCSALSIYSLSVLLSKLPTIATRLHRRRPLLVTRLAAGYAQHALLWEAALGAVYDLRLHFFEGVSAGDVAYRITAEASDLAVTLYTLLNQNGGLTIVPSTLQLSAMMMQMLVLYPFFDFSHDCSLHGASFAFLGQELRKISKEAHVSIAALSAYLNEPGETVAIVGPSGGGCILIDNHNIQNIRLASLRRHVLVISYRLETVMMAKRVFLLDDGKLKELPQSTMLD







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo