SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g21960): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g21960): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma13g21960

Feature Type:gene_model
Chromosome:Gm13
Start:25517993
stop:25519543
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g21960
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G36320AT Annotation by Michelle Graham. TAIR10: A20/AN1-like zinc finger family protein | chr2:15229388-15229873 FORWARD LENGTH=161 SoyBaseE_val: 4.00E-60ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
KOG3173 KOG Predicted Zn-finger protein JGI ISS
PTHR10634Panther PRK1-ASSOCIATED ZINC FINGER PROTEIN JGI ISS
PF01428PFAM AN1-like Zinc finger JGI ISS
PF01754PFAM A20-like zinc finger JGI ISS
UniRef100_B3IX31UniRef Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor C2H2 n=1 Tax=Lotus japonicus RepID=B3IX31_LOTJA SoyBaseE_val: 5.00E-73ISS
UniRef100_I1LZI8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LZI8_SOYBN SoyBaseE_val: 3.00E-120ISS

Expression Patterns of Glyma13g21960
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g21960 not represented in the dataset
Glyma13g21960 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g21960
ParalogEvidenceComments
Glyma10g08280 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g21960 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.11g210000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g21960
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g21960
>Glyma13g21960.1   sequence type=CDS   gene model=Glyma13g21960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGGAAGAACACCGATGCGAAACTCCCGAAGGTCACCTACTCTGCGCCAACAACTGCGGCTTCTCCGGTAGCACCGCCACGATGAACCTCTGCTCGAAATGCTACGGCGCGATCCGCTTGAAGGAGCAAGAAGAAGCGTCGACGAAATCTACAATCGAAACCGCGCTCTCTTCTTCCTCGTTGAAACCGTCGTTCTCCACGTCACCTCCAACGTTGGTGGATGTCCTCATCGAATCGCCGCCGCCGTCTTTGGCGGAGGTTGCGGTCACGGTGGCGGTGGAGGCGTCGAGTTCTATTTCCACAAGCTCAGGTTCGGTTGCGCAACCGAACCGGTGTGCCACGTGTCGGAAGCGCGTGGGGCTGACCGGGTTCAAGTGCAGGTGCGGATTGACGTTCTGCGGGGCCCACAGGTACTCGGAGAAGCACGCGTGCGGGTTCGATTTTAAGACGGTGGGGAGAGAGGAGATTGCACGTGCCAACCCCGTGATCAAAGCGGAGAAGCTGCGGAGGATTTGA
Predicted protein sequences of Glyma13g21960
>Glyma13g21960.1   sequence type=predicted peptide   gene model=Glyma13g21960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAEEHRCETPEGHLLCANNCGFSGSTATMNLCSKCYGAIRLKEQEEASTKSTIETALSSSSLKPSFSTSPPTLVDVLIESPPPSLAEVAVTVAVEASSSISTSSGSVAQPNRCATCRKRVGLTGFKCRCGLTFCGAHRYSEKHACGFDFKTVGREEIARANPVIKAEKLRRI*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo