Glyma13g21520 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g21520

Feature Type:	gene_model
Chromosome:	Gm13
Start:	25080870
stop:	25082975
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma13g21520

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G36620	AT	Annotation by Michelle Graham. TAIR10: ribosomal protein L24 \| chr2:15350548-15351819 REVERSE LENGTH=164	SoyBase	E_val: 5.00E-85	ISS
GO:0001510	GO-bp	Annotation by Michelle Graham. GO Biological Process: RNA methylation	SoyBase	N/A	ISS
GO:0006412	GO-bp	Annotation by Michelle Graham. GO Biological Process: translation	SoyBase	N/A	ISS
GO:0042254	GO-bp	Annotation by Michelle Graham. GO Biological Process: ribosome biogenesis	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0005840	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: ribosome	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0022625	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosolic large ribosomal subunit	SoyBase	N/A	ISS
GO:0003735	GO-mf	Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome	SoyBase	N/A	ISS
KOG1722	KOG	60s ribosomal protein L24	JGI		ISS
PTHR10792	Panther	60S RIBOSOMAL PROTEIN L24	JGI		ISS
PF01246	PFAM	Ribosomal protein L24e	JGI		ISS
UniRef100_I1LZF9	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LZF9_SOYBN	SoyBase	E_val: 5.00E-113	ISS
UniRef100_Q9FUL4	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: 60S ribosomal protein L24 n=1 Tax=Prunus avium RepID=RL24_PRUAV	SoyBase	E_val: 4.00E-89	ISS

Expression Patterns of Glyma13g21520

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g21520

Paralog	Evidence	Comments
Glyma10g07680	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g21520 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma13g21520

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma13g21520

Limit To All Plant Sequences

>Glyma13g21520.1   sequence type=CDS   gene model=Glyma13g21520   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTTCTCAAAACCGAGCTGTGCCGATTCAGCGGTGCCAAGATCTACCCAGGGAAAGGCATCAGATTTGTTCGTGGTGATTCTCAGGTTTTCCTGTTTGCTAACTCAAAATGTAAGAGGTATTTCCACAACAGGTTGAAGCCGTCAAAGCTCACGTGGACTGCAATGTACCGAAAGCAGCATAAGAAGGATATTGCTCAAGAAGCTGTGAAGAAGAGAAGACGTGCTACCAAAAAACCTTACTCTAGGTCTATTGTTGGTGCTACTTTAGAAGTTATCCAGAAAAAGAGAACCGAGAAGCCAGAAGTTCGAGATGCAGCTAGGGAAGCACAGCTTCGTGAAATTAAGGAGAGGATCAAGAAAACTAAGGATGACAAGAAAGCTAAGAAAGCAGAAGTTGCAGCTAAGTCCCAAAAATCACAAGGGAAAGGAAGTATTTCGAAGGGTGCCATGCCCAAAGGTCCCAAACTTGGTGGGGGAGGTGGGAAACGCTGA

Predicted protein sequences of Glyma13g21520

Limit To All Plant Sequences

>Glyma13g21520.1   sequence type=predicted peptide   gene model=Glyma13g21520   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVLKTELCRFSGAKIYPGKGIRFVRGDSQVFLFANSKCKRYFHNRLKPSKLTWTAMYRKQHKKDIAQEAVKKRRRATKKPYSRSIVGATLEVIQKKRTEKPEVRDAAREAQLREIKERIKKTKDDKKAKKAEVAAKSQKSQGKGSISKGAMPKGPKLGGGGGKR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain