Glyma13g21421 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g21421): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g21421): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma13g21421

Feature Type:	gene_model
Chromosome:	Gm13
Start:	24890880
stop:	24892695
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma13g21421

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G61900	AT	Annotation by Michelle Graham. TAIR10: Calcium-dependent phospholipid-binding Copine family protein \| chr5:24855908-24859150 REVERSE LENGTH=578	SoyBase	E_val: 1.00E-131	ISS
GO:0009266	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus	SoyBase	N/A	ISS
GO:0009270	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to humidity	SoyBase	N/A	ISS
GO:0009626	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type hypersensitive response	SoyBase	N/A	ISS
GO:0009627	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance	SoyBase	N/A	ISS
GO:0009690	GO-bp	Annotation by Michelle Graham. GO Biological Process: cytokinin metabolic process	SoyBase	N/A	ISS
GO:0009697	GO-bp	Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process	SoyBase	N/A	ISS
GO:0009863	GO-bp	Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0010186	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of cellular defense response	SoyBase	N/A	ISS
GO:0019725	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular homeostasis	SoyBase	N/A	ISS
GO:0031348	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response	SoyBase	N/A	ISS
GO:0045087	GO-bp	Annotation by Michelle Graham. GO Biological Process: innate immune response	SoyBase	N/A	ISS
GO:0045793	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of cell size	SoyBase	N/A	ISS
GO:0060548	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of cell death	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009506	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma	SoyBase	N/A	ISS
GO:0005544	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calcium-dependent phospholipid binding	SoyBase	N/A	ISS
PTHR10857	Panther	COPINE	JGI		ISS
PF07002	PFAM	Copine	JGI		ISS
UniRef100_B9RA61	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Copine, putative n=1 Tax=Ricinus communis RepID=B9RA61_RICCO	SoyBase	E_val: 1.00E-141	ISS
UniRef100_UPI000233D061	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233D061 related cluster n=1 Tax=unknown RepID=UPI000233D061	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma13g21421

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g21421 not represented in the dataset	Glyma13g21421 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma13g21421 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.13g150400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma13g21421

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma13g21421

Limit To All Plant Sequences

>Glyma13g21421.1   sequence type=CDS   gene model=Glyma13g21421   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTAGAAGTTCAACATAAATTCACAATTACTGCACTGGTGGAGGAGCCTGGATGTGTCCTGTTTACCTTGAGGAACCATTTGTGGGTTCCACAAAATGCTAATCCTCTAAGGCCATTGTTGTCAGGCTCAACAGCTGCTTCAAATGGAAATCCACGCCTTCCAGATTCTTTGCATTATATTGATCCTTCAGGACGACCAAATGCATACCAGAGGGCAATTGTCGAGGTTGGGGAAGTGTTACTGTTGTATGATTCAGACAAACGATTTCCTACTTGGGGATTTGGAGCACGACCAATTGATGGTCCTGTTTCCCATTGTTTCAACTTGAACGGAAGTAGTCATTACTGTGAAGTGGAAGGGATCCAAGGAATTATGATGGCTTACACAAGTGCCCTGCTTAATGTATCTCTTGCAGGACCTACACTTTTTGGACCGGTCATAAGCACTGCTGCACTGATTGCCAGCCAATCTGTAGCAAATGGTGGAAGAAAGTACTTTGTTTTATTAATAATCACAGATGGAGTAGTGACAGATCTCCAAGAAACAAAAGATGCTATTGTTAAAGCATCTGACCTGCCATTATCAATCCTTATTGTTGGGGTAGGAGGAGCTGATTTCAAAGAAATGGAGGTTTTGGATGCAGACAAGGGAGAGAGGCTAGAAAGTTCATATGGACGCGTTGCTTCACGTGATATAGTCCAATTTATTCCATTTCGGGAGGTTCAAAGTGGACTTTCAGTTGTTCAAGCATTTCTAGCAGAATTACCGGCTCAATTTTTAACTTACGTGAGGAGCAGAAATATCCAGCCGAACCTCTAG

Predicted protein sequences of Glyma13g21421

Limit To All Plant Sequences

>Glyma13g21421.1   sequence type=predicted peptide   gene model=Glyma13g21421   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVEVQHKFTITALVEEPGCVLFTLRNHLWVPQNANPLRPLLSGSTAASNGNPRLPDSLHYIDPSGRPNAYQRAIVEVGEVLLLYDSDKRFPTWGFGARPIDGPVSHCFNLNGSSHYCEVEGIQGIMMAYTSALLNVSLAGPTLFGPVISTAALIASQSVANGGRKYFVLLIITDGVVTDLQETKDAIVKASDLPLSILIVGVGGADFKEMEVLDADKGERLESSYGRVASRDIVQFIPFREVQSGLSVVQAFLAELPAQFLTYVRSRNIQPNL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain