SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g20360

Feature Type:gene_model
Chromosome:Gm13
Start:23805182
stop:23807434
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g20360
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G37195AT Annotation by Michelle Graham. TAIR10: unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 23 Blast hits to 23 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr2:15620370-15621464 FORWARD LENGTH=133 SoyBaseE_val: 3.00E-36ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_UPI000233CD77UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233CD77 related cluster n=1 Tax=unknown RepID=UPI000233CD77 SoyBaseE_val: 3.00E-110ISS

Expression Patterns of Glyma13g20360
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g20360
ParalogEvidenceComments
Glyma10g06070 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g20360 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g140300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g20360
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g20360
>Glyma13g20360.2   sequence type=CDS   gene model=Glyma13g20360   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTGGTTGTTGGGTTGGGATCCCAACAACGTTATACTGAAGAGAAGAGTGAGGAACAGACATCACATGACAGAGGAATTATGGGAGCAAGGAGAAGAAGGTCGATCTTGGCCACTCTCGCTTTTCTAATGTTAATGGGCATCGCCCTCTATTTCAGACTCTGGGCTATTCACTACAACCTTTCTTCCGACGACACCCAACTCTTAAGGCTACAGTTTGATATTGCCAACAGAGAGGCAATGGATGAGTCTGCAGAGTGGAGGCTGAGGTATGATGAGGAGGTAGATAGGACAAATAAGTGTTTACAGCAGCTTCAACTGTTTCGGGAGTCCTCTCAGAAGGGGGAAGATGCTTCTGGTATTAACCATGAATTGACAATTCTGCAAAAGGAGAATGCAGTCTTACTTGAAAGGTTGGAAACACTGAAAAGAGAGCTTGAAGAGGAAAGGTTGAAGTGCAGTTCACGATACATGAACTAA
Predicted protein sequences of Glyma13g20360
>Glyma13g20360.2   sequence type=predicted peptide   gene model=Glyma13g20360   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLVVGLGSQQRYTEEKSEEQTSHDRGIMGARRRRSILATLAFLMLMGIALYFRLWAIHYNLSSDDTQLLRLQFDIANREAMDESAEWRLRYDEEVDRTNKCLQQLQLFRESSQKGEDASGINHELTILQKENAVLLERLETLKRELEEERLKCSSRYMN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo