SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g19355

Feature Type:gene_model
Chromosome:Gm13
Start:22890075
stop:22895406
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g19355
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G02520AT Annotation by Michelle Graham. TAIR10: CONTAINS InterPro DOMAIN/s: SANT associated (InterPro:IPR015216); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT1G58210.1); Has 842 Blast hits to 736 proteins in 154 species: Archae - 2; Bacteria - 99; Metazoa - 236; Fungi - 52; Plants - 90; Viruses - 0; Other Eukaryotes - 363 (source: NCBI BLink). | chr5:561325-563840 FORWARD LENGTH=598 SoyBaseE_val: 3.00E-30ISS
GO:0006270GO-bp Annotation by Michelle Graham. GO Biological Process: DNA replication initiation SoyBaseN/AISS
GO:0006275GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of DNA replication SoyBaseN/AISS
GO:0006346GO-bp Annotation by Michelle Graham. GO Biological Process: methylation-dependent chromatin silencing SoyBaseN/AISS
GO:0007267GO-bp Annotation by Michelle Graham. GO Biological Process: cell-cell signaling SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0009616GO-bp Annotation by Michelle Graham. GO Biological Process: virus induced gene silencing SoyBaseN/AISS
GO:0010267GO-bp Annotation by Michelle Graham. GO Biological Process: production of ta-siRNAs involved in RNA interference SoyBaseN/AISS
GO:0031048GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing by small RNA SoyBaseN/AISS
GO:0035196GO-bp Annotation by Michelle Graham. GO Biological Process: production of miRNAs involved in gene silencing by miRNA SoyBaseN/AISS
GO:0048451GO-bp Annotation by Michelle Graham. GO Biological Process: petal formation SoyBaseN/AISS
GO:0048453GO-bp Annotation by Michelle Graham. GO Biological Process: sepal formation SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0051726GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF09133PFAM SANTA (SANT Associated) JGI ISS
UniRef100_G7KDV8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Kinetochore-associated protein KNL-2-like protein n=1 Tax=Medicago truncatula RepID=G7KDV8_MEDTR SoyBaseE_val: 7.00E-17ISS
UniRef100_UPI000233CBFEUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233CBFE related cluster n=1 Tax=unknown RepID=UPI000233CBFE SoyBaseE_val: 0ISS

Expression Patterns of Glyma13g19355
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g19355 not represented in the dataset
Glyma13g19355 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g19355
ParalogEvidenceComments
Glyma10g04995 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g19355 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g131100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g19355
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g19355
>Glyma13g19355.1   sequence type=CDS   gene model=Glyma13g19355   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGATTCCACTCCGACTGCAACTCCTTCAAACGACATCGTATCAAGCTCTTTCCGACGAACGGTCACCTTATACGATTGGTGGTTGGTTATAGCCAAAAACGACTTCCAAGGAAAGCGTTTAGCCGTCGCTGGCGTCTCGTCGAGAAAGGATGAGGCAACGCGTGTGTTTGTTTCTGCTGCTGTTATCAAAAGATATGACGTGTTTTCTCTCGAGACTGCGGATGGGATATGCGTCATAATCAGGGGCTTCATCAACGAGCAGCGCACTCTCGAAAATGGTTTTTCCGCCGAGGTTTTCCACCATTTTTTATTTGGCTTTCCTCCAGACTGGGAAAGGTATGCTCTAGATTGCTTCAAAGAAGAACCTACCACTGATGCTGATTTGGGTAGTGTTGTTCCTGATAATGCACCAGCTAGCTGTCCAAAAATTTTATCTGATGGTGTGGAAAAATCTATTCCTACCTGTTTGGTATCACCAGAGGAGGCCTCAGGAGATCACGAAATGTCATTCCCCGAAAATGAATGCAACGTGTCAAAGGAGATGGGTGGGGTTCATGTTGCTTGTAGTAGTGGTGGGAAAAGCCATAGTTTCAAGTTGCACAATATTAAAGTATGCCAGCAGAAGAAGCAGCCTGCTTCTGAATGTCTTCCGAACCATCCAGATAATGAGAACTCTAGTTCAGTGGCCTTGGAGAATTGTAATGTAGAGAGACTGGAAAGTCCGACAACACCCATTCAGCCGCAATTGTGGAGTGAATATTCAAACGATGCTTGTGTGGAAAATGCTATTCCTACTTCTTTGGCATCAGAGGAGGCCCCGGGAGATCATGAGAAGTCATTCCCTGAAAATGAATCCAACGTGTCAAAGGAAATTAATGGGGTTAATGTTGCTTGTAGTAGTGGTGGGAAAAGTCGTAGTGCCAGGTTGCATGATATTAAAGTATACCAGCAGAAGAAGCCTGCTTCTGGAGGGTCTCTGAAGCATCCAAATAATGAGAACTCTACTTCAGTGGCCTTGGAGAATTGTGATGTAAAGGGACTGAAAAGTCCAGCAACACCCATTCAGTCACAATCGTCAAGACAACTAAGCACATCACCTGGGCAGGTAATTAAAAAATCTGCATCCAAAATTTCTAGAACATTGTCACCAAAGACTGAAGGCTGTTATAAGAAAAAGAGAGTGACAGTTGAAACAAAAGTGGTCATGCCCAAGGGAAAACTGAATAAATCTGCATCTGCTTTGAAAAATCCACGAGAAAAGGATCTAAGCCCCTTGGCCAAGGGAAGCCAACAGAAAATATCCACATTTACTCCAGAGTCACTAAGTTTCAGAAAATCCAGATCCGGTAGGTTGCTTCTACCTCCCTTAGAGTTTTGGCGCAATCAAATACCAATTTATAATGCGGACCACGAGATTACAGAAATTCGGGATGGTGCATCTCTGATATCACCTTGTAGAGGTTTTTCACCATCATTGAGTAGGTTTAGCAATCAAAAACGTGGAGCGTGA
Predicted protein sequences of Glyma13g19355
>Glyma13g19355.1   sequence type=predicted peptide   gene model=Glyma13g19355   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MADSTPTATPSNDIVSSSFRRTVTLYDWWLVIAKNDFQGKRLAVAGVSSRKDEATRVFVSAAVIKRYDVFSLETADGICVIIRGFINEQRTLENGFSAEVFHHFLFGFPPDWERYALDCFKEEPTTDADLGSVVPDNAPASCPKILSDGVEKSIPTCLVSPEEASGDHEMSFPENECNVSKEMGGVHVACSSGGKSHSFKLHNIKVCQQKKQPASECLPNHPDNENSSSVALENCNVERLESPTTPIQPQLWSEYSNDACVENAIPTSLASEEAPGDHEKSFPENESNVSKEINGVNVACSSGGKSRSARLHDIKVYQQKKPASGGSLKHPNNENSTSVALENCDVKGLKSPATPIQSQSSRQLSTSPGQVIKKSASKISRTLSPKTEGCYKKKRVTVETKVVMPKGKLNKSASALKNPREKDLSPLAKGSQQKISTFTPESLSFRKSRSGRLLLPPLEFWRNQIPIYNADHEITEIRDGASLISPCRGFSPSLSRFSNQKRGA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo