Glyma13g17530 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g17530

Feature Type:	gene_model
Chromosome:	Gm13
Start:	21313982
stop:	21316748
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma13g17530

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G20850	AT	Annotation by Michelle Graham. TAIR10: RAS associated with diabetes protein 51 \| chr5:7070758-7072860 REVERSE LENGTH=342	SoyBase	E_val: 0	ISS
GO:0000724	GO-bp	Annotation by Michelle Graham. GO Biological Process: double-strand break repair via homologous recombination	SoyBase	N/A	ISS
GO:0006259	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA metabolic process	SoyBase	N/A	ISS
GO:0006261	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA-dependent DNA replication	SoyBase	N/A	ISS
GO:0006275	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of DNA replication	SoyBase	N/A	ISS
GO:0006281	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA repair	SoyBase	N/A	ISS
GO:0006302	GO-bp	Annotation by Michelle Graham. GO Biological Process: double-strand break repair	SoyBase	N/A	ISS
GO:0006306	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA methylation	SoyBase	N/A	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009314	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to radiation	SoyBase	N/A	ISS
GO:0009555	GO-bp	Annotation by Michelle Graham. GO Biological Process: pollen development	SoyBase	N/A	ISS
GO:0010212	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to ionizing radiation	SoyBase	N/A	ISS
GO:0010332	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to gamma radiation	SoyBase	N/A	ISS
GO:0016444	GO-bp	Annotation by Michelle Graham. GO Biological Process: somatic cell DNA recombination	SoyBase	N/A	ISS
GO:0022402	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell cycle process	SoyBase	N/A	ISS
GO:0031047	GO-bp	Annotation by Michelle Graham. GO Biological Process: gene silencing by RNA	SoyBase	N/A	ISS
GO:0045003	GO-bp	Annotation by Michelle Graham. GO Biological Process: double-strand break repair via synthesis-dependent strand annealing	SoyBase	N/A	ISS
GO:0051726	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003684	GO-mf	Annotation by Michelle Graham. GO Molecular Function: damaged DNA binding	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
GO:0008094	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA-dependent ATPase activity	SoyBase	N/A	ISS
GO:0017111	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity	SoyBase	N/A	ISS
KOG1433	KOG	DNA repair protein RAD51/RHP55	JGI		ISS
PTHR22942	Panther	RECA/RAD51/RADA DNA STRAND-PAIRING FAMILY MEMBER	JGI		ISS
PTHR22942:SF12	Panther	DNA REPAIR PROTEIN RAD51	JGI		ISS
PF08423	PFAM	Rad51	JGI		ISS
UniRef100_G7JS36	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: DNA repair protein RAD51-like protein n=1 Tax=Medicago truncatula RepID=G7JS36_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1LYB2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LYB2_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma13g17530

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g17530

Paralog	Evidence	Comments
Glyma17g04980	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g17530 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.13g115000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma13g17530

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma13g17530

Limit To All Plant Sequences

>Glyma13g17530.1   sequence type=CDS   gene model=Glyma13g17530   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGGCAACCATGGAGCAGCAACGCCACCAAAAAGCGCCCCAACAACAAGACGAAGCCGAAGAGATACAACCTGGCCCTTTACCCGTCGAGCAACTTCAGGCATCGGGCATAGCCGCCACGGACGTTAAGAAGCTTAAAGACGCCGGAATTTGCACCGTTGAATCCGTTGCTTACACTCCTAGGAAAGACCTTTTGCAAATCAAAGGTATCAGTGAAGCTAAAGTTGACAAGATCATTGAAGCAGCTTCTAAGCTGGTGCCTATGGGTTTCACCAGCGCTAGTGAACTTCATGCCCAGCGCGATGCAATCATTCAGATAACCACGGGATCAAGAGAGCTTGACAAGATATTGGAGGGTGGAGTTGAGACCGGTTCTATAACTGAATTATATGGTGAATTTCGGTCTGGGAAGACTCAGTTGTGTCACACTCTCTGTGTCACTTGCCAATTGCCACTAGACCAAGGAGGTGGGGAGGGTAAAGCTATGTACATAGATGCTGAGGGCACATTTAGGCCTCAGCGACTCTTACAGATAGCAGATAGGTTTGGATTGAATGGTGTTGATGTATTGGAAAATGTTGCTTATGCTAGAGCATACAATACTGATCATCAATCACGGCTTCTGCTTGAAGCAGCTTCAATGATGGTGGAAACTAGGTTTGCTGTAATGATAGTAGATAGTGCTACTGCCCTCTATAGGACAGATTTTTCTGGAAGGGGGGAGCTTTCAGCTCGGCAAATGCATCTAGCAAAGTTCCTGAGGAGCCTTCAGAAATTAGCAGATGAGTTTGGTGTGGCTATTGTCATAACAAACCAAGTAGTTTCACAAGTAGATGGTTCTGCAGTCTTTGCTGGACCTCAAATCAAGCCTATTGGAGGCAACATTATGGCTCATGCTACAACAACGAGGCTAGCTCTCAGGAAAGGGAGAGGGGAAGAGCGAATCTGTAAAGTGATAAGTTCTCCTTGCTTGGCGGAAGCCGAAGCAAGGTTTCAGATTTGTGCCGAAGGAGTTTCAGATGTTAAAGACTAA

Predicted protein sequences of Glyma13g17530

Limit To All Plant Sequences

>Glyma13g17530.1   sequence type=predicted peptide   gene model=Glyma13g17530   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSATMEQQRHQKAPQQQDEAEEIQPGPLPVEQLQASGIAATDVKKLKDAGICTVESVAYTPRKDLLQIKGISEAKVDKIIEAASKLVPMGFTSASELHAQRDAIIQITTGSRELDKILEGGVETGSITELYGEFRSGKTQLCHTLCVTCQLPLDQGGGEGKAMYIDAEGTFRPQRLLQIADRFGLNGVDVLENVAYARAYNTDHQSRLLLEAASMMVETRFAVMIVDSATALYRTDFSGRGELSARQMHLAKFLRSLQKLADEFGVAIVITNQVVSQVDGSAVFAGPQIKPIGGNIMAHATTTRLALRKGRGEERICKVISSPCLAEAEARFQICAEGVSDVKD*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain