SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g17090

Feature Type:gene_model
Chromosome:Gm13
Start:20917289
stop:20918441
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g17090
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G05910AT Annotation by Michelle Graham. TAIR10: Protein of unknown function (DUF567) | chr2:2258512-2259376 REVERSE LENGTH=191 SoyBaseE_val: 3.00E-40ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005575GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cellular component SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF04525PFAM Protein of unknown function (DUF567) JGI ISS
UniRef100_I1LY66UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1LY66_SOYBN SoyBaseE_val: 4.00E-79ISS
UniRef100_Q01J32UniRef Annotation by Michelle Graham. Most informative UniRef hit: OSIGBa0140O07.11 protein n=3 Tax=Oryza sativa RepID=Q01J32_ORYSA SoyBaseE_val: 5.00E-30ISS

Expression Patterns of Glyma13g17090
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g17090
ParalogEvidenceComments
Glyma17g05630 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g17090 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g111100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g17090
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g17090
>Glyma13g17090.1   sequence type=CDS   gene model=Glyma13g17090   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTTGAGGCCCTGAGCATTTACAAGAAGTGGAAAGGTTATAGCTTAGACTACGAAGGATCAAGGAAGCTGATTTTCAGCTTGAGAGAATCCAATTCTTGTTTTGTTAAGAACAATGCAATCAGAATCTTCACTAGGAACAGAGGCTGTGACTTTAAGATCAGTGGCTGTTTCCCGGATAAGTGTTGTAGCATTGTTGACTCCAAAGGCAACGAGGTAGCCCAGGTGAGGATGATGAAGGAAGTGGAGAAATTGATTGAAAGCAAGGATTTGTACCATGTAGTGGTGAATCCTGGGATGGATCAAGCTTTTGTCTTTGGAGTCATCGCTATCCTTGATTACATTTATGGCGAATCTACCCACTGCTAA
Predicted protein sequences of Glyma13g17090
>Glyma13g17090.1   sequence type=predicted peptide   gene model=Glyma13g17090   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVEALSIYKKWKGYSLDYEGSRKLIFSLRESNSCFVKNNAIRIFTRNRGCDFKISGCFPDKCCSIVDSKGNEVAQVRMMKEVEKLIESKDLYHVVVNPGMDQAFVFGVIAILDYIYGESTHC*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo