Glyma13g16940 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g16940): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g16940): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma13g16940

Feature Type:	gene_model
Chromosome:	Gm13
Start:	20802267
stop:	20807803
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma13g16940

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G06050	AT	Annotation by Michelle Graham. TAIR10: oxophytodienoate-reductase 3 \| chr2:2359240-2361971 REVERSE LENGTH=391	SoyBase	E_val: 0	ISS
GO:0006569	GO-bp	Annotation by Michelle Graham. GO Biological Process: tryptophan catabolic process	SoyBase	N/A	ISS
GO:0007165	GO-bp	Annotation by Michelle Graham. GO Biological Process: signal transduction	SoyBase	N/A	ISS
GO:0009414	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to water deprivation	SoyBase	N/A	ISS
GO:0009611	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to wounding	SoyBase	N/A	ISS
GO:0009620	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to fungus	SoyBase	N/A	ISS
GO:0009684	GO-bp	Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process	SoyBase	N/A	ISS
GO:0009694	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid metabolic process	SoyBase	N/A	ISS
GO:0009695	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process	SoyBase	N/A	ISS
GO:0009723	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus	SoyBase	N/A	ISS
GO:0009733	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus	SoyBase	N/A	ISS
GO:0009738	GO-bp	Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009753	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus	SoyBase	N/A	ISS
GO:0009867	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0010193	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to ozone	SoyBase	N/A	ISS
GO:0042538	GO-bp	Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response	SoyBase	N/A	ISS
GO:0055114	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process	SoyBase	N/A	ISS
GO:0005777	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: peroxisome	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0010181	GO-mf	Annotation by Michelle Graham. GO Molecular Function: FMN binding	SoyBase	N/A	ISS
GO:0016491	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity	SoyBase	N/A	ISS
GO:0016629	GO-mf	Annotation by Michelle Graham. GO Molecular Function: 12-oxophytodienoate reductase activity	SoyBase	N/A	ISS
KOG0134	KOG	NADH:flavin oxidoreductase/12-oxophytodienoate reductase	JGI		ISS
PTHR22893	Panther	NADH OXIDOREDUCTASE-RELATED	JGI		ISS
PTHR22893:SF13	Panther	12-OXOPHYTODIENOATE REDUCTASE OPR	JGI		ISS
PF00724	PFAM	NADH:flavin oxidoreductase / NADH oxidase family	JGI		ISS
UniRef100_B9RRB8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: 12-oxophytodienoate reductase opr, putative n=1 Tax=Ricinus communis RepID=B9RRB8_RICCO	SoyBase	E_val: 0	ISS
UniRef100_I1LY51	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LY51_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma13g16940

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g16940 not represented in the dataset	Glyma13g16940 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g16940

Paralog	Evidence	Comments
Glyma17g05780	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g16940 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.13g109700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma13g16940

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma13g16940

Limit To All Plant Sequences

>Glyma13g16940.1   sequence type=CDS   gene model=Glyma13g16940   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCGATAATGCAACAACGCAAGGAAGCAACACCCTATTTTCTCCTTACAAGATGGCCAAATTCAACCTCTCTCATAGGGTGGTGTTGGCTCCTATGACAAGATGCAGAGCGTTGAACTGGATTCCACAGGCAGCGCTTGCTGAATACTACGCTCAAAGATCAACACCAGGTGGATTTCTCATCAGCGAAGGCACCTTGATCTCCCCCACTGCTCCTGGGTTTCCCCATGTTCCCGGGATATATTCAGATGAACAAGTGGAGGCGTGGCGAAACATAGTGGATGCCGTGCATGCCAAAGGCAGCATTATCTTCTGTCAACTTTGGCATGTTGGCCGTGCCTCTCATCCAGTGTATCAACCTGGTGGAGCTCCACCAATTTCGTCCACCAGCAAGCCCATATCGGCGAGGTGGAGGATTCTGCTTCCCGATGGGTCCTATGGTGTGTACCCAGAGCCTCGTGCACTTAGCACTTCTGAGATACCTGAAATAGTGCAGCATTATCGCCAAGCAGCAATTAATGCAATTCGAGCAGGTTTTGATGGAATCGAGATTCATGGGGCACATGGGTATCTCATTGATCAATTCTTAAAGGATGGAATCAATGATCGAACAGATGAATATGGTGGATCACTAGCAAACCGGTGCAGGTTCCTAATGCAGGTGGTTCAAGCAGTTGTTTCTGCTATTGGTGCGGAAAGAGTTGCTGTCAGAATTTCACCAGCAATTGATCACCTTGATGCCATTGATTCTGACCCACTTAAGCTAGGCTTGGCAGTGGTTGAGAGACTCAACAATTTCCAGAAAGAACTGGGCAGAAAACTCACTTATCTTCATGTTACTCAGCCTCGATACACAGCTTATGGCCAAACCGAGTCAGGTAGACCTGGGAGTGAAGAGGAGGAGGCTCATTTGATGCAGAACTTGAGAAAGGCTTATGAGGGAACATTCATGTGTAGTGGTGGCTTTACTAGGAAGTTGGGAATGGAAGCTGTAGCTGAAGGCCATGCTGACTTGGTATCCTATGGTCGACTTTTCATCTCCAATCCAGACTTGGTTTTAAGGCTTAAGCTTAATGCACCTCTTACCAAGTATAACAGGAAGACATTTTACACCCAGGATCCTGTTATAGGATACACAGATTATCCTTTCCTAAGCAAAGAAAGTGAGACAAAGGAGCCAAGGGCACGCCTTTAA

Predicted protein sequences of Glyma13g16940

Limit To All Plant Sequences

>Glyma13g16940.1   sequence type=predicted peptide   gene model=Glyma13g16940   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MADNATTQGSNTLFSPYKMAKFNLSHRVVLAPMTRCRALNWIPQAALAEYYAQRSTPGGFLISEGTLISPTAPGFPHVPGIYSDEQVEAWRNIVDAVHAKGSIIFCQLWHVGRASHPVYQPGGAPPISSTSKPISARWRILLPDGSYGVYPEPRALSTSEIPEIVQHYRQAAINAIRAGFDGIEIHGAHGYLIDQFLKDGINDRTDEYGGSLANRCRFLMQVVQAVVSAIGAERVAVRISPAIDHLDAIDSDPLKLGLAVVERLNNFQKELGRKLTYLHVTQPRYTAYGQTESGRPGSEEEEAHLMQNLRKAYEGTFMCSGGFTRKLGMEAVAEGHADLVSYGRLFISNPDLVLRLKLNAPLTKYNRKTFYTQDPVIGYTDYPFLSKESETKEPRARL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain