Glyma13g16580 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g16580

Feature Type:	gene_model
Chromosome:	Gm13
Start:	20503428
stop:	20511462
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma13g16580

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G19430	AT	Annotation by Michelle Graham. TAIR10: DWD (DDB1-binding WD40 protein) hypersensitive to ABA 1 \| chr2:8415217-8417740 FORWARD LENGTH=367	SoyBase	E_val: 3.00E-169	ISS
GO:0006281	GO-bp	Annotation by Michelle Graham. GO Biological Process: DNA repair	SoyBase	N/A	ISS
GO:0009788	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of abscisic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0010100	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of photomorphogenesis	SoyBase	N/A	ISS
GO:0010267	GO-bp	Annotation by Michelle Graham. GO Biological Process: production of ta-siRNAs involved in RNA interference	SoyBase	N/A	ISS
GO:0016567	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein ubiquitination	SoyBase	N/A	ISS
GO:0031047	GO-bp	Annotation by Michelle Graham. GO Biological Process: gene silencing by RNA	SoyBase	N/A	ISS
GO:0048608	GO-bp	Annotation by Michelle Graham. GO Biological Process: reproductive structure development	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0080008	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: CUL4-RING ubiquitin ligase complex	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
KOG0649	KOG	WD40 repeat protein	JGI		ISS
PTHR22847	Panther	WD40 REPEAT PROTEIN	JGI		ISS
PTHR22847:SF1	Panther	WD REPEAT PROTEIN	JGI		ISS
PF00400	PFAM	WD domain, G-beta repeat	JGI		ISS
UniRef100_I1LY15	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LY15_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q8L4M1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: WD repeat-containing protein DWA1 n=1 Tax=Arabidopsis thaliana RepID=DWA1_ARATH	SoyBase	E_val: 1.00E-166	ISS

Expression Patterns of Glyma13g16580

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g16580

Paralog	Evidence	Comments
Glyma17g06100	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g16580 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.13g106300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma13g16580

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma13g16580

Limit To All Plant Sequences

>Glyma13g16580.1   sequence type=CDS   gene model=Glyma13g16580   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTGCGGCGACGCCACGAACTGGGACGAAGACGCATACAGAGAAACCGTACTCAGGGAGAGGGAAATCCAAACCCGAACCGTTTTCCGAACCGCTTGGGCCCCACCCTACACCTCTAACCTCGACACTCTCCTTGTCGCCTCTAGCGACGGTTCCGTCGCATCCTACTCCATCTCTTCCTCCGTCGTCGCCTCTAAGCTCAAAAATCCATTCGGTTTTGTCAATGCCGATACAGATGAGTTATTGGCTGAACCAAATTGCTTCGTTCAAGCGCACGCTGGACCTGCTTACGATGTCAAGTTTTATGGTGACGGCGAAGATGCTCTGTTGCTGAGCTGTGGTGATGATGGTCAGATTCGAGGATGGAGATGGAAGGAATTTTCAAGCTCAAATTATTCTGTTTCTTCCCAAGGAAATGATATCAAGCCTGTACTTGATGTGGTGAATCCTCAACACAAAGGTCCTTGGGGTGCACTTTCACCCGTCCCAGAGAATAATGCTATTGCTGTCAATACTCAGGGGGGATCTGTTTTTGCCGCATCTGGTGATTCTTGTGCATATTGTTGGGATGTGGAAACTGGTAAAGTGAAAATGGTATTCAAGGGGCACATGGACTATTTGCATTGTATAGTTGCTCGCAACTCATCAAATCAGATCATAACAGGTTCGGAGGATGGGACAACACGAATTTGGGATTGCAAAAGTGGAAAGTGTACGCAAGTGATTGATCCAGCAAGAGATTTGAAATTAAAGGGATCTGCTTCATGGGTTGGTTGTGTTGCTTTAGATGCAAGTGAGAGCTGGTTGGCTTGCAGTAGTGGACGTAATATATCACTTTGGAACCTTCCTGCTTCAGAATGCGTATCAAAGATTCCAACTCGTGCTTGTGTACAAGACATGTCATTTGACAATAATCAAATTTTGACAGTTGGTACAGATCCTCTACTCAATCGCTTTGACATGAATGGCACTATCCTTTCACAAATACAGTGTGCTCCTTCGTCATCTTTTTCTATCTCCTTACATCCTGCAGGGGTTATGGCAGTTGGAGGTTATGGATGTCTTGTTGATGTTATCTCACAATTTGGCAGCCACATGTGCACATTTCGTTGCCAGTGTGTCTAA

Predicted protein sequences of Glyma13g16580

Limit To All Plant Sequences

>Glyma13g16580.1   sequence type=predicted peptide   gene model=Glyma13g16580   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MCGDATNWDEDAYRETVLREREIQTRTVFRTAWAPPYTSNLDTLLVASSDGSVASYSISSSVVASKLKNPFGFVNADTDELLAEPNCFVQAHAGPAYDVKFYGDGEDALLLSCGDDGQIRGWRWKEFSSSNYSVSSQGNDIKPVLDVVNPQHKGPWGALSPVPENNAIAVNTQGGSVFAASGDSCAYCWDVETGKVKMVFKGHMDYLHCIVARNSSNQIITGSEDGTTRIWDCKSGKCTQVIDPARDLKLKGSASWVGCVALDASESWLACSSGRNISLWNLPASECVSKIPTRACVQDMSFDNNQILTVGTDPLLNRFDMNGTILSQIQCAPSSSFSISLHPAGVMAVGGYGCLVDVISQFGSHMCTFRCQCV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain