SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma13g16570

Feature Type:gene_model
Chromosome:Gm13
Start:20499402
stop:20502367
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G13920AT Annotation by Michelle Graham. TAIR10: eukaryotic translation initiation factor 4A1 | chr3:4592635-4594128 REVERSE LENGTH=412 SoyBaseE_val: 0ISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006413GO-bp Annotation by Michelle Graham. GO Biological Process: translational initiation SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005730GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleolus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003743GO-mf Annotation by Michelle Graham. GO Molecular Function: translation initiation factor activity SoyBaseN/AISS
GO:0004386GO-mf Annotation by Michelle Graham. GO Molecular Function: helicase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0008026GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP-dependent helicase activity SoyBaseN/AISS
KOG0327 KOG Translation initiation factor 4F, helicase subunit (eIF-4A) and related helicases JGI ISS
PTHR24031Panther FAMILY NOT NAMED JGI ISS
PTHR24031:SF2Panther SUBFAMILY NOT NAMED JGI ISS
PF00270PFAM DEAD/DEAH box helicase JGI ISS
PF00271PFAM Helicase conserved C-terminal domain JGI ISS
UniRef100_E5GB87UniRef Annotation by Michelle Graham. Most informative UniRef hit: Helicase n=1 Tax=Cucumis melo subsp. melo RepID=E5GB87_CUCME SoyBaseE_val: 0ISS
UniRef100_I1L1K7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L1K7_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma17g06110 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g106200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma13g16570.1   sequence type=CDS   gene model=Glyma13g16570   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGGACTTGCACCTGAGGGATCACAGTTCGATGCTCGTCAATATGATTCTAAAATGAGTGACTTACTTTCATCTGATGGACAGGACTTCTTCACATCCTATGACGAGGTTTATGATAGTTTTGACGCTATGGGTTTGCAGGAAAATCTTCTCAGGGGAATTTACGCATATGGTTTTGAGAAGCCATCTGCCATTCAGCAAAGGGGGATAGTTCCCTTCTGCAAGGGACTTGATGTTATTCAGCAGGCTCAGTCTGGAACTGGGAAGACGGCTACTTTCTGCTCTGGTATTCTGCAGCAACTTGACTATAGCTTGACGCAATGCCAGGCCTTGGTTTTAGCACCAACTCGTGAGCTTGCTCAGCAGATTGAGAAGGTTATGCGAGCACTTGGAGATTATCTAGGTGTGAAGGTTCATGCTTGTGTGGGAGGTACCAGTGTGCGTGAAGACCAACGCATTCTATCTAGCGGTGTTCATGTTGTGGTTGGTACCCCTGGTCGTGTGTTTGATATGCTGCGCAGACAGTCACTTCTGCCAGATCACATCAAGATGTTTGTATTGGATGAGGCTGATGAAATGCTTTCCCGAGGTTTTAAGGATCAGATCTACGATATATTTCAGCTGCTGCCATCTAAGATTCAAGTGGGAGTTTTCTCTGCTACAATGCCTCCTGAGGCCCTTGAGATCACTAGGAAGTTTATGAACAAACCTGTTAGGATCCTTGTGAAGCGTGATGAGCTCACCTTGGAGGGTATTAAGCAATTTTATGTCAATGTTGAGAGGGAGGATTGGAAGCTGGACACACTCTGCGATCTTTACGAGACATTAGCTATCACTCAGAGTGTCATTTTTGTTAATACCAGAAGGAAAGTTGATTGGTTGACTGACAAGATGAGAAGCCGTGACCACACAGTCTCAGCAACCCACGGAGACATGGACCAGAATACCAGGGACATTATTATGCGTGAATTCCGTTCTGGGTCTTCCCGTGTCTTGATAACCACTGATCTTTTGGCTCGTGGTATTGATGTGCAACAAGTGTCTCTAGTTATAAACTTTGATCTCCCTACACAGCCTGAGAACTATCTCCACCGTATTGGTCGTAGTGGGAGGTTCGGAAGGAAAGGTGTTGCGATCAATTTTGTCACAAAGGATGACGAGAAAATGCTGTTTGACATCCAGAAGTTTTACAACGTGCAAGTTGAGGAGCTGCCTTCAAATGTTGCTGAGCTCCTTTGA

>Glyma13g16570.1   sequence type=predicted peptide   gene model=Glyma13g16570   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAGLAPEGSQFDARQYDSKMSDLLSSDGQDFFTSYDEVYDSFDAMGLQENLLRGIYAYGFEKPSAIQQRGIVPFCKGLDVIQQAQSGTGKTATFCSGILQQLDYSLTQCQALVLAPTRELAQQIEKVMRALGDYLGVKVHACVGGTSVREDQRILSSGVHVVVGTPGRVFDMLRRQSLLPDHIKMFVLDEADEMLSRGFKDQIYDIFQLLPSKIQVGVFSATMPPEALEITRKFMNKPVRILVKRDELTLEGIKQFYVNVEREDWKLDTLCDLYETLAITQSVIFVNTRRKVDWLTDKMRSRDHTVSATHGDMDQNTRDIIMREFRSGSSRVLITTDLLARGIDVQQVSLVINFDLPTQPENYLHRIGRSGRFGRKGVAINFVTKDDEKMLFDIQKFYNVQVEELPSNVAELL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo