SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g15560

Feature Type:gene_model
Chromosome:Gm13
Start:19447591
stop:19448499
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g15560
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
ATCG00020AT Annotation by Michelle Graham. TAIR10: photosystem II reaction center protein A | chrC:383-1444 REVERSE LENGTH=353 SoyBaseE_val: 0ISS
GO:0006091GO-bp Annotation by Michelle Graham. GO Biological Process: generation of precursor metabolites and energy SoyBaseN/AISS
GO:0006354GO-bp Annotation by Michelle Graham. GO Biological Process: DNA-dependent transcription, elongation SoyBaseN/AISS
GO:0009772GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthetic electron transport in photosystem II SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009523GO-cc Annotation by Michelle Graham. GO Cellular Compartment: photosystem II SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0010287GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastoglobule SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0030076GO-cc Annotation by Michelle Graham. GO Cellular Compartment: light-harvesting complex SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0016168GO-mf Annotation by Michelle Graham. GO Molecular Function: chlorophyll binding SoyBaseN/AISS
GO:0045156GO-mf Annotation by Michelle Graham. GO Molecular Function: electron transporter, transferring electrons within the cyclic electron transport pathway of photosynthesis activity SoyBaseN/AISS
PF00124PFAM Photosynthetic reaction centre protein JGI ISS
UniRef100_I1LXY5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1LXY5_SOYBN SoyBaseE_val: 0ISS
UniRef100_P02957UniRef Annotation by Michelle Graham. Most informative UniRef hit: Photosystem Q(B) protein n=1 Tax=Glycine max RepID=PSBA_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma13g15560
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma13g15560 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g028200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g15560
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g15560
>Glyma13g15560.1   sequence type=CDS   gene model=Glyma13g15560   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TCTGTATTTATCATCACTTTTATTGCTGCCCCTCTAGTAGATATTGATGGTATTCGTGAGCCTGTTTCTGGATCTCTACTTTATGGAAACAATATCATTTCTGGTGCCATTATTCCTACTTCTGCGGCTATAGGTTTGCACTTTTATCCTATTTGGGAAGCGGCATCTGTTGATGAATGGTTATATAACGGCGGTCCTTATGAACTAATTATTCTACACTTCTTACTTGGTGTAGCTTGCTACATGGGGCGTGAGTGGGAACTTAGTTTTCCCGCTACTGCTGTTTTCTTGATCTATCCTATTGGTCAGGGAAGCTTTTCAGATGGTATGCCTCTAGGAATTTCAGGTACTTCCAATTTTATGATTGTATTTCAGGCTAAGCATAATATTCTTATGCATCCATTTCACATGTTGGTTGTAGCTGGTGTATTCGGCGGCTCCTTATTTAGTGCTATGCATGATTCCTTGGTAACTTTTAGTTTGATCAGGGAAACCACAGAAAATGAATCTGCTAATGAAGGTTACAGATTTGGTCAAGAGGAGGAAACCTATAATATTGTAGTTGCTCATGGTTATTTTGGCCGATTGATCTTCCAATATGCAAGTTTCAACAATTCTCGTTCTTTACATTTCTTCTTTGCTGCTTGGCCTATAGTAGGTATTTGGTTTACCGCTTTAGGTATCAACACTATGGCTTTCAACTTAAATGGTTTCAATTTCAACCAATCCGTAGTTGATAGTCAAGGTCGTGTAATTAATACCTGGGCTGATATTATTAACCGAGCTAACCTTGGTATGGAAGTAATGCATGAACGTAATGCTCATAATTTCCCTCTAGATCTAGCTGCGATCGACGCTCCATCTATTAATGGATAA
Predicted protein sequences of Glyma13g15560
>Glyma13g15560.1   sequence type=predicted peptide   gene model=Glyma13g15560   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
SVFIITFIAAPLVDIDGIREPVSGSLLYGNNIISGAIIPTSAAIGLHFYPIWEAASVDEWLYNGGPYELIILHFLLGVACYMGREWELSFPATAVFLIYPIGQGSFSDGMPLGISGTSNFMIVFQAKHNILMHPFHMLVVAGVFGGSLFSAMHDSLVTFSLIRETTENESANEGYRFGQEEETYNIVVAHGYFGRLIFQYASFNNSRSLHFFFAAWPIVGIWFTALGINTMAFNLNGFNFNQSVVDSQGRVINTWADIINRANLGMEVMHERNAHNFPLDLAAIDAPSING*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo