SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g13040): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g13040): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma13g13040

Feature Type:gene_model
Chromosome:Gm13
Start:16708297
stop:16710571
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G07800AT Annotation by Michelle Graham. TAIR10: Thymidine kinase | chr3:2489944-2490935 REVERSE LENGTH=238 SoyBaseE_val: 2.00E-101ISS
GO:0009061GO-bp Annotation by Michelle Graham. GO Biological Process: anaerobic respiration SoyBaseN/AISS
GO:0009165GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide biosynthetic process SoyBaseN/AISS
GO:0019690GO-bp Annotation by Michelle Graham. GO Biological Process: pyrimidine deoxyribonucleoside interconversion SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0004797GO-mf Annotation by Michelle Graham. GO Molecular Function: thymidine kinase activity SoyBaseN/AISS
KOG3125 KOG Thymidine kinase JGI ISS
PTHR11441Panther THYMIDINE KINASE JGI ISS
PF00265PFAM Thymidine kinase JGI ISS
UniRef100_I1LXW1UniRef Annotation by Michelle Graham. Best UniRef hit: Thymidine kinase n=1 Tax=Glycine max RepID=I1LXW1_SOYBN SoyBaseE_val: 2.00E-156ISS
UniRef100_I1LXW1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Thymidine kinase n=1 Tax=Glycine max RepID=I1LXW1_SOYBN SoyBaseE_val: 2.00E-156ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g13040 not represented in the dataset

Glyma13g13040 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g025800 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma13g13040.1   sequence type=CDS   gene model=Glyma13g13040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCTCTTCTTCGTCCCTCTCATTGGACACAGCCAAAGACCTTTCGAACTCATCTGGTGAGGTTCATGTCATCGTCGGTCCCATGTTCGCTGGCAAGACCACTGCCCTTCTTTGTCGCATCGAATCCGAACTCAACGCTGCCAAGAATGTGGTGTTGTTAAAATCGAGCAAGGATACAAGATATGCAATTGACTCGGTTGTGACGCACGATGGGATTAAATTTCCTTGCAGGGCGTTACCGGATCTGTTGTCGTTCAGGGAAAAACACGGCGATGATGCTTATCAGAAGTTGGATGTGATTGGCATAGACGAGGCTCAATTTTTTGAGGACCTATACGAGTTTTGCTGCAAGGCTGCTGATGAAGATGGCAAAACCGTAATTGTTGCAGGCCTGGATGGTGATTACTTAAGGAGAAGCTTTGGCTCTGTGCTTCACATAATTCCACTTGCTGATTCTGTGACCAAACTAACAGCACGTTGTGAACTGTGTGGCAAACGTGCTTTTTTCACCTTGAGGAAGACAGAGCAGAGAGAGACTGAACTAATTGGTGGGGCTGATTTGTATATGCCGGTTTGTCGCCTGCACTACCTGAACAGCCAAGTTGCTGAGAGGAGTGTTCTCGAATCTCAAAATTTTAAAACCGATTGA

>Glyma13g13040.1   sequence type=predicted peptide   gene model=Glyma13g13040   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASSSSLSLDTAKDLSNSSGEVHVIVGPMFAGKTTALLCRIESELNAAKNVVLLKSSKDTRYAIDSVVTHDGIKFPCRALPDLLSFREKHGDDAYQKLDVIGIDEAQFFEDLYEFCCKAADEDGKTVIVAGLDGDYLRRSFGSVLHIIPLADSVTKLTARCELCGKRAFFTLRKTEQRETELIGGADLYMPVCRLHYLNSQVAERSVLESQNFKTD*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo