SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma13g10470

Feature Type:gene_model
Chromosome:Gm13
Start:12322210
stop:12323987
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G10050AT Annotation by Michelle Graham. TAIR10: L-O-methylthreonine resistant 1 | chr3:3099164-3101741 REVERSE LENGTH=592 SoyBaseE_val: 2.00E-32ISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006520GO-bp Annotation by Michelle Graham. GO Biological Process: cellular amino acid metabolic process SoyBaseN/AISS
GO:0006566GO-bp Annotation by Michelle Graham. GO Biological Process: threonine metabolic process SoyBaseN/AISS
GO:0007010GO-bp Annotation by Michelle Graham. GO Biological Process: cytoskeleton organization SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009097GO-bp Annotation by Michelle Graham. GO Biological Process: isoleucine biosynthetic process SoyBaseN/AISS
GO:0010498GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal protein catabolic process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004794GO-mf Annotation by Michelle Graham. GO Molecular Function: L-threonine ammonia-lyase activity SoyBaseN/AISS
GO:0030170GO-mf Annotation by Michelle Graham. GO Molecular Function: pyridoxal phosphate binding SoyBaseN/AISS
PF00585PFAM C-terminal regulatory domain of Threonine dehydratase JGI ISS
UniRef100_D2DKF2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Threonine deaminase (Fragment) n=1 Tax=Glycine max RepID=D2DKF2_SOYBN SoyBaseE_val: 6.00E-44ISS
UniRef100_UPI000233B25BUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233B25B related cluster n=1 Tax=unknown RepID=UPI000233B25B SoyBaseE_val: 2.00E-59ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma13g10470.1   sequence type=CDS   gene model=Glyma13g10470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATATATCATGACCAGAGAGTGATTTTGGACCAGGTTGGGGAATTTGCAGATGGTGTAGCTGTTAAAGAGGAGTTGATAGATGGGGTTGTTCTTGTAAGCCGTGATTCAATTTGTTGTTCAGTTGGAGTTTTTATTGGTCCAAATGTAGCTCTTCTATTCGGGAAAGATATTGTAGTGAAAACCAGAGAAGCACACATGAATTTTGATTTGATAAACTTCGGGTTGTTGTGCTGGCAACTGTTATGGCAGAGGAGCCTGGCAGTTTCAAAAAATTTGCGAATTGGACAGATCAACATCACAGAATTCAAATACAAATATAACTTGAATGAGGCGGTTGTCCTTTGCGGTGTTGGGGTTCACATAGTTTCCGAACTAAGAGCAATGCAGGAGAGGATGGAATCTTCTCAGCTCAAAACTTACAATCTCACAGAAAGTGACATGGTGAAAAATCACTTGTGTTACTTG

>Glyma13g10470.1   sequence type=predicted peptide   gene model=Glyma13g10470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
IYHDQRVILDQVGEFADGVAVKEELIDGVVLVSRDSICCSVGVFIGPNVALLFGKDIVVKTREAHMNFDLINFGLLCWQLLWQRSLAVSKNLRIGQINITEFKYKYNLNEAVVLCGVGVHIVSELRAMQERMESSQLKTYNLTESDMVKNHLCYL







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo