SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g10470): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g10470): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma13g10470

Feature Type:gene_model
Chromosome:Gm13
Start:12322210
stop:12323987
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g10470
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G10050AT Annotation by Michelle Graham. TAIR10: L-O-methylthreonine resistant 1 | chr3:3099164-3101741 REVERSE LENGTH=592 SoyBaseE_val: 2.00E-32ISS
GO:0006094GO-bp Annotation by Michelle Graham. GO Biological Process: gluconeogenesis SoyBaseN/AISS
GO:0006520GO-bp Annotation by Michelle Graham. GO Biological Process: cellular amino acid metabolic process SoyBaseN/AISS
GO:0006566GO-bp Annotation by Michelle Graham. GO Biological Process: threonine metabolic process SoyBaseN/AISS
GO:0007010GO-bp Annotation by Michelle Graham. GO Biological Process: cytoskeleton organization SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009097GO-bp Annotation by Michelle Graham. GO Biological Process: isoleucine biosynthetic process SoyBaseN/AISS
GO:0010498GO-bp Annotation by Michelle Graham. GO Biological Process: proteasomal protein catabolic process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004794GO-mf Annotation by Michelle Graham. GO Molecular Function: L-threonine ammonia-lyase activity SoyBaseN/AISS
GO:0030170GO-mf Annotation by Michelle Graham. GO Molecular Function: pyridoxal phosphate binding SoyBaseN/AISS
PF00585PFAM C-terminal regulatory domain of Threonine dehydratase JGI ISS
UniRef100_D2DKF2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Threonine deaminase (Fragment) n=1 Tax=Glycine max RepID=D2DKF2_SOYBN SoyBaseE_val: 6.00E-44ISS
UniRef100_UPI000233B25BUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233B25B related cluster n=1 Tax=unknown RepID=UPI000233B25B SoyBaseE_val: 2.00E-59ISS

Expression Patterns of Glyma13g10470
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g10470 not represented in the dataset
Glyma13g10470 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma13g10470 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma13g10470
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g10470
>Glyma13g10470.1   sequence type=CDS   gene model=Glyma13g10470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATATATCATGACCAGAGAGTGATTTTGGACCAGGTTGGGGAATTTGCAGATGGTGTAGCTGTTAAAGAGGAGTTGATAGATGGGGTTGTTCTTGTAAGCCGTGATTCAATTTGTTGTTCAGTTGGAGTTTTTATTGGTCCAAATGTAGCTCTTCTATTCGGGAAAGATATTGTAGTGAAAACCAGAGAAGCACACATGAATTTTGATTTGATAAACTTCGGGTTGTTGTGCTGGCAACTGTTATGGCAGAGGAGCCTGGCAGTTTCAAAAAATTTGCGAATTGGACAGATCAACATCACAGAATTCAAATACAAATATAACTTGAATGAGGCGGTTGTCCTTTGCGGTGTTGGGGTTCACATAGTTTCCGAACTAAGAGCAATGCAGGAGAGGATGGAATCTTCTCAGCTCAAAACTTACAATCTCACAGAAAGTGACATGGTGAAAAATCACTTGTGTTACTTG
Predicted protein sequences of Glyma13g10470
>Glyma13g10470.1   sequence type=predicted peptide   gene model=Glyma13g10470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
IYHDQRVILDQVGEFADGVAVKEELIDGVVLVSRDSICCSVGVFIGPNVALLFGKDIVVKTREAHMNFDLINFGLLCWQLLWQRSLAVSKNLRIGQINITEFKYKYNLNEAVVLCGVGVHIVSELRAMQERMESSQLKTYNLTESDMVKNHLCYL






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo