SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g10090

Feature Type:gene_model
Chromosome:Gm13
Start:11654554
stop:11659324
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g10090
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G44110AT Annotation by Michelle Graham. TAIR10: Cyclin A1;1 | chr1:16775035-16777182 REVERSE LENGTH=460 SoyBaseE_val: 0ISS
GO:0000079GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cyclin-dependent protein kinase activity SoyBaseN/AISS
GO:0000911GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinesis by cell plate formation SoyBaseN/AISS
GO:0006260GO-bp Annotation by Michelle Graham. GO Biological Process: DNA replication SoyBaseN/AISS
GO:0006270GO-bp Annotation by Michelle Graham. GO Biological Process: DNA replication initiation SoyBaseN/AISS
GO:0006275GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of DNA replication SoyBaseN/AISS
GO:0006306GO-bp Annotation by Michelle Graham. GO Biological Process: DNA methylation SoyBaseN/AISS
GO:0008283GO-bp Annotation by Michelle Graham. GO Biological Process: cell proliferation SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0010103GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal complex morphogenesis SoyBaseN/AISS
GO:0010389GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of G2/M transition of mitotic cell cycle SoyBaseN/AISS
GO:0010583GO-bp Annotation by Michelle Graham. GO Biological Process: response to cyclopentenone SoyBaseN/AISS
GO:0016458GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing SoyBaseN/AISS
GO:0016572GO-bp Annotation by Michelle Graham. GO Biological Process: histone phosphorylation SoyBaseN/AISS
GO:0034968GO-bp Annotation by Michelle Graham. GO Biological Process: histone lysine methylation SoyBaseN/AISS
GO:0042127GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell proliferation SoyBaseN/AISS
GO:0051322GO-bp Annotation by Michelle Graham. GO Biological Process: anaphase SoyBaseN/AISS
GO:0051329GO-bp Annotation by Michelle Graham. GO Biological Process: interphase of mitotic cell cycle SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0051726GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0016538GO-mf Annotation by Michelle Graham. GO Molecular Function: cyclin-dependent protein kinase regulator activity SoyBaseN/AISS
GO:0019901GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase binding SoyBaseN/AISS
KOG0654 KOG G2/Mitotic-specific cyclin A JGI ISS
PTHR10177Panther CYCLINS JGI ISS
PTHR10177:SF49Panther G2/MITOTIC-SPECIFIC CYCLIN JGI ISS
PF00134PFAM Cyclin, N-terminal domain JGI ISS
PF02984PFAM Cyclin, C-terminal domain JGI ISS
UniRef100_I1LXG2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LXG2_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q39879UniRef Annotation by Michelle Graham. Most informative UniRef hit: Mitotic cyclin a2-type n=1 Tax=Glycine max RepID=Q39879_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma13g10090
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma13g10090 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g031500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g10090
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g10090
>Glyma13g10090.1   sequence type=CDS   gene model=Glyma13g10090   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGTCGACGACGCAGAATCGTCGTTCGTCGTTTACTTCCTCGACGGCGTCGTCTTTGGCGAAAGCGAAACGACATCCATCGTCGGTGTCGTCGTCGTCGTCGGGGAAGGCGAAGGTGGTTTCTACTCAGAACTTGGCTGTGAAGAGAGCGCCTCTCGCCAACCTCACTAATCAAAGGAACGCGCCTTATTCTTCTTCTTCTTCTTCTTTGGTGCAAGGTTCAAATAAAGTTGCCAAGACCAAGAAAGAGGCTCCTGCAAGAACCAGCGTCTCAAAATCAACAATTTCTGGGAACAAATCTTCCCAGTTAAAATCTGTTAACTCAAGCTCCGTTGTTATTCCAAAGGCTAATTCTTTATCACAAAAGAAGGATGCTGCTCCCACAGTTGCCACATTTGCCGTGCCTGTTCGTAGCGGCATTGATGTTTCTCCTAGTAAATCAGATGGAAGGTTCGTTTCTATGGATGAGACAACATCTTCATGTGATTCTATCAAGAGTCCGGATGAAGTTGAATATCTGGATAACAGGGATGTTTCAGATGTTGATTCAATTCAGAAAAAGATAATAAGCAATTTGAACATTTCTGATACCACAGAGCCCGAAGGAAACGTATGTAGTAGGGAAATAATTGTTGAGTTGGAAGAAAGAGTGGACAAGATTGTCAATATCGATAACATTTACTCTGATACGCAGCTTTGTGCAACCTATGTTTGTGACATCTACAAACACCTACGTGAATCCGAGGAAAAGAAAAGGCCTTCCACTGACTTCATGGACACAATTCAGAAGGACATAAATGTTAGCATGCGCGCTATATTGGTTGACTGGCTTGTTGAGGTGGCTGAGGAGTATCGTCTTGTACCTGAAACATTGTATTTGACAGTGAACTACTTAGATCGGTATCTTTCAGGGAATGCTATGAATAGGCAAAGGTTACAACTTCTTGGTGTTTCATGCATGATGATTGCATCTAAATATGAGGAGATTTGTGCACCTCAGGTGGAAGAATTTCGTTATATAACTGACAATACTTACTTAAAAGAAGAGGTTTTGCAAATGGAATCTGCTGTCTTGAATTATCTTGAGTTCGAAATGACAGCCCCAACAGTTAAATGTTTCTTAAGACGATTTGTTCGTGCGGCTGCTCATGATGTCCAGGAGATCCCTTCACTTCAACTGGAGTGTCTAACCAACTTTATTGCCGAATTATCTCTCTTGGAGTACAGTATGCTGTGTTATCCTCCATCACAAATAGCTGCCTCTGCAATTTTCCTTGCCAGATTTATACTTTTCCCTTCAAAGAAACCATGGAATTCCACATTGCAGCATTACACGCTCTACCGGCCTTCGGACTTGTGTGCATGTGTAAAAGATCTCCATCGTCTTTGTTGCAGCAGCCATGATTCTAATTTACCTGCAATCAGAGATAAATACAGTCAGCATAAGTACAAATGTGTGGCCAAGAAGTGCATCCCTCCTTCAATACCTCAAGAAGTTTTCCAGAGTTGA
Predicted protein sequences of Glyma13g10090
>Glyma13g10090.1   sequence type=predicted peptide   gene model=Glyma13g10090   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSSTTQNRRSSFTSSTASSLAKAKRHPSSVSSSSSGKAKVVSTQNLAVKRAPLANLTNQRNAPYSSSSSSLVQGSNKVAKTKKEAPARTSVSKSTISGNKSSQLKSVNSSSVVIPKANSLSQKKDAAPTVATFAVPVRSGIDVSPSKSDGRFVSMDETTSSCDSIKSPDEVEYLDNRDVSDVDSIQKKIISNLNISDTTEPEGNVCSREIIVELEERVDKIVNIDNIYSDTQLCATYVCDIYKHLRESEEKKRPSTDFMDTIQKDINVSMRAILVDWLVEVAEEYRLVPETLYLTVNYLDRYLSGNAMNRQRLQLLGVSCMMIASKYEEICAPQVEEFRYITDNTYLKEEVLQMESAVLNYLEFEMTAPTVKCFLRRFVRAAAHDVQEIPSLQLECLTNFIAELSLLEYSMLCYPPSQIAASAIFLARFILFPSKKPWNSTLQHYTLYRPSDLCACVKDLHRLCCSSHDSNLPAIRDKYSQHKYKCVAKKCIPPSIPQEVFQS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo