Glyma13g09470 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g09470

Feature Type:	gene_model
Chromosome:	Gm13
Start:	10895574
stop:	10904406
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma13g09470

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G77230	AT	Annotation by Michelle Graham. TAIR10: Tetratricopeptide repeat (TPR)-like superfamily protein \| chr1:29016129-29017873 FORWARD LENGTH=218	SoyBase	E_val: 2.00E-68	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
PTHR15544	Panther	UNCHARACTERIZED	JGI		ISS
PF02259	PFAM	FAT domain	JGI		ISS
UniRef100_I1LXC7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LXC7_SOYBN	SoyBase	E_val: 7.00E-139	ISS
UniRef100_O80657	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: T14N5.9 protein n=1 Tax=Arabidopsis thaliana RepID=O80657_ARATH	SoyBase	E_val: 5.00E-61	ISS

Expression Patterns of Glyma13g09470

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g09470

Paralog	Evidence	Comments
Glyma14g25073	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g09470 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.13g035500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma13g09470

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma13g09470

Limit To All Plant Sequences

>Glyma13g09470.1   sequence type=CDS   gene model=Glyma13g09470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAAGTGACTTGGAAGAACAAGAAGAAGAAACGTTGTTTACCCACGTTGTCACACTTCACTGACCTTCCCTTTGAGCATAATCATCAACAACACTCCAACACCGACGCTGAAGATGGCGCGCATGTTCCCGACGCCACACAATTGGCTAACGAATTTCAAGCTCAAGGAGACAAGCTTGCTATGGATGGGAAGTACCGGGAAGCACTAGGTAAATGGGAAGCTGCTCTTGCGTTGGCGCCTGATGTTCCAGTTGTGCATGAACAAAAGGCCCAAGTTTTACTAGAAACTGGAGATGCTTGGAATGCTTTAAAGGCTGCTACTCGAGCTACTGAATTGGACCCATCATGGGCTGAGGCATGGGTCACACTTGGCAGAGCACAACTTAATTTTGGTGAGCCTGATAATGCTATTGAAAGCTTTGACCGTGCTCTAGCTCTCAAGCCTGATTATGAGGAAGCTCAAGATGATAGGAAAACTGCATCACGTCTTGTTAAGAAGAGAAAGCAACTTCACTCATCTGGCCTGAGTGCCACTCAAAATCGTTATATGGTTGGTGAAAAGGATGAAAACCAGTAA

Predicted protein sequences of Glyma13g09470

Limit To All Plant Sequences

>Glyma13g09470.1   sequence type=predicted peptide   gene model=Glyma13g09470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKVTWKNKKKKRCLPTLSHFTDLPFEHNHQQHSNTDAEDGAHVPDATQLANEFQAQGDKLAMDGKYREALGKWEAALALAPDVPVVHEQKAQVLLETGDAWNALKAATRATELDPSWAEAWVTLGRAQLNFGEPDNAIESFDRALALKPDYEEAQDDRKTASRLVKKRKQLHSSGLSATQNRYMVGEKDENQ*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain