SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g08901): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g08901): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma13g08901

Feature Type:gene_model
Chromosome:Gm13
Start:9663107
stop:9665271
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g08901
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G21360AT Annotation by Michelle Graham. TAIR10: glycolipid transfer protein 2 | chr1:7481365-7483237 FORWARD LENGTH=223 SoyBaseE_val: 1.00E-76ISS
GO:0046836GO-bp Annotation by Michelle Graham. GO Biological Process: glycolipid transport SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0017089GO-mf Annotation by Michelle Graham. GO Molecular Function: glycolipid transporter activity SoyBaseN/AISS
GO:0051861GO-mf Annotation by Michelle Graham. GO Molecular Function: glycolipid binding SoyBaseN/AISS
KOG3221 KOG Glycolipid transfer protein JGI ISS
PTHR10219Panther GLYCOLIPID TRANSFER PROTEIN-RELATED JGI ISS
PTHR10219:SF4Panther HET-C JGI ISS
PF08718PFAM Glycolipid transfer protein (GLTP) JGI ISS
UniRef100_G7J670UniRef Annotation by Michelle Graham. Most informative UniRef hit: Pleckstrin homology domain-containing protein n=1 Tax=Medicago truncatula RepID=G7J670_MEDTR SoyBaseE_val: 1.00E-99ISS
UniRef100_I3SB29UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Lotus japonicus RepID=I3SB29_LOTJA SoyBaseE_val: 2.00E-115ISS

Expression Patterns of Glyma13g08901
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g08901 not represented in the dataset
Glyma13g08901 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma13g08901 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g039200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g08901
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g08901
>Glyma13g08901.1   sequence type=CDS   gene model=Glyma13g08901   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAATATGGAAAGGGAAGGGAATAAAATGAAGAGCACTAGGAGAGAAATGGAGAAGAAGTCAGAGATAGGTTTAGTCATTGAAGAGCTTTCTATGATAGCCATAGTTAAACCTGGTGAAAATCATGACTCTGCTCACATCCCCACCAAGCTTTTCCTCTCGATTTGTTACTTGGTTCTACAAGTTCTTGATAAGATTGGGCCAACAATGGCTGTCTTGAGACAGGACGTGTACCAGAATATTAAGACATTGGAACTGATGCAGGAATCAAATCCCTCATTGCACTCGAATTTGGTTGAGATATTGAAGTCAGAAGCAACCGAAGGCAATTCTTGGAAAGGGTCAAGCTGCAGTAAGGCCCTTGTTTGGCTCACTAGGACCCTGGATTTCACCTCGCTGTTGTTACAAACACTAGCAAATGATCCTGAAAAGAGAATGGAACAAATAGTTGAAGAGGCTTATGATGTAACTTTAAAACCGTGGCATGGATGGATTTCATCAACTGCTTTCAGAGTGGCTCTAAAACTGGTACCTGAAAGTAAAACATTCGTGAATATTCTTAAAACTGAAGATGAAAACTATGACACCCTAAAGGAGAAAATGCAGATGCTGGTTTCTCTGTTTGTGCCTTTTCTTGAGGATATGCATTGTATTCTGAGATTGTACAACTTGGACAAGCTAAAGTCAACCTGA
Predicted protein sequences of Glyma13g08901
>Glyma13g08901.1   sequence type=predicted peptide   gene model=Glyma13g08901   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNMEREGNKMKSTRREMEKKSEIGLVIEELSMIAIVKPGENHDSAHIPTKLFLSICYLVLQVLDKIGPTMAVLRQDVYQNIKTLELMQESNPSLHSNLVEILKSEATEGNSWKGSSCSKALVWLTRTLDFTSLLLQTLANDPEKRMEQIVEEAYDVTLKPWHGWISSTAFRVALKLVPESKTFVNILKTEDENYDTLKEKMQMLVSLFVPFLEDMHCILRLYNLDKLKST*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo