SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g08831

Feature Type:gene_model
Chromosome:Gm13
Start:9549734
stop:9550825
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g08831
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G21326AT Annotation by Michelle Graham. TAIR10: VQ motif-containing protein | chr1:7469002-7469721 REVERSE LENGTH=239 SoyBaseE_val: 3.00E-21ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF05678PFAM VQ motif JGI ISS
UniRef100_G7J659UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein MKS1 n=1 Tax=Medicago truncatula RepID=G7J659_MEDTR SoyBaseE_val: 7.00E-61ISS
UniRef100_UPI000233AF80UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233AF80 related cluster n=1 Tax=unknown RepID=UPI000233AF80 SoyBaseE_val: 6.00E-167ISS

Proteins Associated with Glyma13g08831
LocusGene SymbolProtein Name
VQ51 VQ motif containing protein gene 51

Expression Patterns of Glyma13g08831
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g08831 not represented in the dataset
Glyma13g08831 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma13g08831 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g039800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g08831
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g08831
>Glyma13g08831.1   sequence type=CDS   gene model=Glyma13g08831   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAACTCACAAGACATTCCCTCAGGAAGATCACCAAAAAGACAACTCCAAGGCCCTCGTCCTCCACCTCTTAGGATAAACAAGGACTCCCACAAGATCAAGAAGAAGCCCCCGGTGGCGCCGCCTTCATCACAACCGCAACCACCGCTGCGCCAACCGGTGATCATCTACACCGTCTCTCCGAAAGTAATCCACACCACACCAAGTGACTTCATGAGCCTCGTTCAACGCCTCACCAGCTCTTCGTCTTCCTCTTCATCGTCCTCTTCCAATAAGGTCTCAATCGACCCTTTAAATGGCAACAAAGGCCATGGTGGTGGTAGTGGCATAGTTTCGCCCGCGGGTCGATACGCCACAATAGAGATGGCTAGAACAACAACTCAAAGCACTAAACAACACCCAATTGAGAATAGTGATGATGTTGGAGGGGTAGATTTAGTAGGTCATGGGGTGTTGTTGAAGAGACCAAACATGTTTCATGGGATTTTGTCCCCGGGACCATCTTCGTCTTTATCTCCCATTCCTTCAAATTTCTTCTCTCCACCGTCGATTGATCCAAACATGGGTAGCTTTTATCATGATTTAAGCCCCATCCTTCGTAATAACAGAAATTTCATGGAGGGTACTACTACTACTGCTACTTTCATCATGCCTAGCCCTTCAAACTTTGTTTCACCTCGTACTCCTTCCATTGACCTATTCAATAATTTCTCCGACAATTAA
Predicted protein sequences of Glyma13g08831
>Glyma13g08831.1   sequence type=predicted peptide   gene model=Glyma13g08831   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNSQDIPSGRSPKRQLQGPRPPPLRINKDSHKIKKKPPVAPPSSQPQPPLRQPVIIYTVSPKVIHTTPSDFMSLVQRLTSSSSSSSSSSSNKVSIDPLNGNKGHGGGSGIVSPAGRYATIEMARTTTQSTKQHPIENSDDVGGVDLVGHGVLLKRPNMFHGILSPGPSSSLSPIPSNFFSPPSIDPNMGSFYHDLSPILRNNRNFMEGTTTTATFIMPSPSNFVSPRTPSIDLFNNFSDN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo