Glyma13g07900 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g07900

Feature Type:	gene_model
Chromosome:	Gm13
Start:	8129886
stop:	8131649
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma13g07900

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G64260	AT	Annotation by Michelle Graham. TAIR10: EXORDIUM like 2 \| chr5:25703980-25704897 FORWARD LENGTH=305	SoyBase	E_val: 1.00E-154	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0046685	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to arsenic-containing substance	SoyBase	N/A	ISS
GO:0005618	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cell wall	SoyBase	N/A	ISS
GO:0005794	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0009505	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall	SoyBase	N/A	ISS
GO:0009506	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
PF04674	PFAM	Phosphate-induced protein 1 conserved region	JGI		ISS
UniRef100_E4MW96	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: mRNA, clone: RTFL01-07-O09 n=1 Tax=Eutrema halophilum RepID=E4MW96_THEHA	SoyBase	E_val: 8.00E-153	ISS
UniRef100_I1LX52	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LX52_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma13g07900

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g07900

Paralog	Evidence	Comments
Glyma08g07590	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g07900 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.13g043900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma13g07900

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma13g07900

Limit To All Plant Sequences

>Glyma13g07900.1   sequence type=CDS   gene model=Glyma13g07900   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCTTAAATTACAACATTGCCCTCGCCTTCTCTACGGTTCTCACGCTGCTTCTCCTTCCCTTACCAACCCTTGGGGAGCTCGTGCAGGAGCAGCCACTAGTCCTCAAGTACCACAACGGCCAACTCCTGAAGGGGCGCATCACCGTCAATCTCATCTGGTACGGCACCTTCACCCCGATCCAACGGTCCATAATCGTGGACTTCATAAACTCACTAAGCAGCGCGCCAAACGCGCCGCTTCCATCGACTGCCACGTGGTGGAAAACCACGGAGAAGTACAAGGGGGGAGGATCCTCTGCGCTCGTCGTAGGGAAGCAGTTCCTACACTCGGCTTACTCGTTAGGGAAAAATCTCAAAGGGAAAGACGTCCTCGCACTCGCGTCCAAGTTCAACGAACTGAAATCCATAACGGTCGTATTAACGGCGAAAGACGTCGCCGTTGAGGGCTTTTGCATGAGCCGCTGCGGGACCCACGGCTCTACCCGCAACGTCAAAAACGCTGCCCGGACAGCTTATATTTGGGTTGGAAACTCCGAAACTCAGTGCCCCGGGCAATGCGCGTGGCCATTCCACCAACCCATTTACGGGCCCCAGACGCCGCCGTTAGTCGCGCCTAACGGCGACGTCGGAGTTGACGGAATGGTTATTAACTTGGCCACTCTTCTCGCTGGCACCGTTACGAACCCTTTCAACAACGGTTACTTCCAAGGCCCCCCGACCGCGCCGTTGGAGGCCGTTTCCGCTTGCACGGGCGTTTTCGGTAGCGGATCGTACCCGGGTTATCCGGGTCGGGTTCTCGTGGATAAAGCAACCGGGGCTAGCTACAATGCGCATGGTGCGAATGGAAGAAGGTACCTCGTGCCAGCGATGTGGGACCCGCAGACTTCGACATGCAAGACCCTCGTCTGA

Predicted protein sequences of Glyma13g07900

Limit To All Plant Sequences

>Glyma13g07900.1   sequence type=predicted peptide   gene model=Glyma13g07900   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALNYNIALAFSTVLTLLLLPLPTLGELVQEQPLVLKYHNGQLLKGRITVNLIWYGTFTPIQRSIIVDFINSLSSAPNAPLPSTATWWKTTEKYKGGGSSALVVGKQFLHSAYSLGKNLKGKDVLALASKFNELKSITVVLTAKDVAVEGFCMSRCGTHGSTRNVKNAARTAYIWVGNSETQCPGQCAWPFHQPIYGPQTPPLVAPNGDVGVDGMVINLATLLAGTVTNPFNNGYFQGPPTAPLEAVSACTGVFGSGSYPGYPGRVLVDKATGASYNAHGANGRRYLVPAMWDPQTSTCKTLV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain