SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g06541

Feature Type:gene_model
Chromosome:Gm13
Start:6760387
stop:6761673
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g06541
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G59700AT Annotation by Michelle Graham. TAIR10: Protein kinase superfamily protein | chr5:24052613-24055102 REVERSE LENGTH=829 SoyBaseE_val: 4.00E-72ISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0009832GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall biogenesis SoyBaseN/AISS
GO:0010413GO-bp Annotation by Michelle Graham. GO Biological Process: glucuronoxylan metabolic process SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0042138GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation SoyBaseN/AISS
GO:0045132GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation SoyBaseN/AISS
GO:0045492GO-bp Annotation by Michelle Graham. GO Biological Process: xylan biosynthetic process SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0004672GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase activity SoyBaseN/AISS
GO:0004674GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
GO:0016772GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups SoyBaseN/AISS
KOG1187 KOG Serine/threonine protein kinase JGI ISS
PTHR24420Panther FAMILY NOT NAMED JGI ISS
PF07714PFAM Protein tyrosine kinase JGI ISS
UniRef100_C6ZRP3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Serine-threonine kinase n=1 Tax=Glycine max RepID=C6ZRP3_SOYBN SoyBaseE_val: 3.00E-75ISS
UniRef100_UPI000233AB1BUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233AB1B related cluster n=1 Tax=unknown RepID=UPI000233AB1B SoyBaseE_val: 0ISS

Expression Patterns of Glyma13g06541
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g06541 not represented in the dataset
Glyma13g06541 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma13g06541 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g053900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g06541
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g06541
>Glyma13g06541.1   sequence type=CDS   gene model=Glyma13g06541   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTTCCTTTTCCCTGTCTACCATGCTTCACCACAAAATCCAACACCACAAACCACTTCACCCCAATAGAACAACTCTGCCACCGCTTCTCTCTTGCACAGCTTCAAGCAGCCACAAACGGGTTCAACCCAAGTTTATTTCTTGGTGGAGAAGGCCCATGTCAGGTCTACAAAGCCCACCTCAAAGCCCATGGAGACGTTGTCATCAAGCGCTTCAAGACTAGAAGCCCAGCTGGGGAAATAGAATTCAGGGCCGAAGTCAAGATTCTGTGTCAACTACACCACCCAAACATTGTTCCTTTGATTGGTTTCTGTGAGCACAAAAATGACAAGTTCGTTGTGTTTAATTATGTCCCTAATGGAAGCCTCTATGATTGCTTGCATGGCACCAACAATAACAATGTTCTTGTTCCCTTGTCATGGAAACAAAGACTTCACATCTGCATTGGTGTGGCTCGTGGACTACACTACATTCATTTTGGAACCAAGATACCTATCATGCATCGTGCAGTGACATCAAGCAACATTCTTTTGGACCATAATTTGGTGCCTAAAGTTGCAGATTTTGGACTCTGCAAGAAGCAACCCGAAGGCAAAGGGGAGTCTAGGCCAAAACCACCAAGAGTTGAGTTGAGGGAGAACTTGGAGCTTAGTTTGGAATATTTAGAGCCGGAGTATAGAATTACTGGAAGGTTATCACATAAATCTGATGTGTACTCTTTTGGGGTGGTTATGTTGGAGATTTTGTGCAGGAAGGAAGCGTGTTTTTCGACCCCGGGTAGAGACTGTTGTGAGTATCTTGTCAAATGGGCCTTTGATGATGAAAGGAAGGGGGTTCCTGAGAAGATTGTTGATCCATCTCTCACGGGAAAAATAGCACCTGCTTGTTGGGAAATGTTCATTGAGATCGTTCAGAGATGTCTGGCTTCAGTTGAAGAGAGGCCAAGGATGGGTGAAGTGGAGGTGGTTCTTGAAAATGCATTGCTGTTGCAAGAGAGAGCAGATGCTGTGAAGGAGCTAGTGTGA
Predicted protein sequences of Glyma13g06541
>Glyma13g06541.1   sequence type=predicted peptide   gene model=Glyma13g06541   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVPFPCLPCFTTKSNTTNHFTPIEQLCHRFSLAQLQAATNGFNPSLFLGGEGPCQVYKAHLKAHGDVVIKRFKTRSPAGEIEFRAEVKILCQLHHPNIVPLIGFCEHKNDKFVVFNYVPNGSLYDCLHGTNNNNVLVPLSWKQRLHICIGVARGLHYIHFGTKIPIMHRAVTSSNILLDHNLVPKVADFGLCKKQPEGKGESRPKPPRVELRENLELSLEYLEPEYRITGRLSHKSDVYSFGVVMLEILCRKEACFSTPGRDCCEYLVKWAFDDERKGVPEKIVDPSLTGKIAPACWEMFIEIVQRCLASVEERPRMGEVEVVLENALLLQERADAVKELV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo