Glyma13g06450 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g06450

Feature Type:	gene_model
Chromosome:	Gm13
Start:	6668763
stop:	6671088
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma13g06450

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
UniRef100_C6SVN4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SVN4_SOYBN	SoyBase	E_val: 4.00E-69	ISS

Expression Patterns of Glyma13g06450

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g06450

Paralog	Evidence	Comments
Glyma19g04015	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g06450 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.13g054800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma13g06450

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma13g06450

Limit To All Plant Sequences

>Glyma13g06450.1   sequence type=CDS   gene model=Glyma13g06450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGAAGGGTTTCTCCCTTGTGCTGCTGATTCTTCTGATCCAGTACAACAACGTTGTCAACGCCTACAACAACAAAAACTGTGTCACAGAGGATTGCCTCATCGGCAACAAGGATTTGGAATCAGAGTTCTACTTTGGATCCCATGTGGCCAGAATGCTCTACGATGTGAGCCAATCTGTGAGTGGCAAAACAGGCAATAAAAATAACAAAGCTGTTAATTGTCCAAATAAGCAAGGCTACCGAAGCTGCTTGCCTTCCAAAAACGGTGGTGGCCCTAAGCAAAGTTGTGGCGATTACACCAGGGTTTGCTAA

Predicted protein sequences of Glyma13g06450

Limit To All Plant Sequences

>Glyma13g06450.1   sequence type=predicted peptide   gene model=Glyma13g06450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKKGFSLVLLILLIQYNNVVNAYNNKNCVTEDCLIGNKDLESEFYFGSHVARMLYDVSQSVSGKTGNKNNKAVNCPNKQGYRSCLPSKNGGGPKQSCGDYTRVC*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain