SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g06410

Feature Type:gene_model
Chromosome:Gm13
Start:6652142
stop:6656983
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g06410
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G15610AT Annotation by Michelle Graham. TAIR10: Proteasome component (PCI) domain protein | chr5:5079579-5081929 FORWARD LENGTH=413 SoyBaseE_val: 0ISS
GO:0006302GO-bp Annotation by Michelle Graham. GO Biological Process: double-strand break repair SoyBaseN/AISS
GO:0006312GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic recombination SoyBaseN/AISS
GO:0007062GO-bp Annotation by Michelle Graham. GO Biological Process: sister chromatid cohesion SoyBaseN/AISS
GO:0007129GO-bp Annotation by Michelle Graham. GO Biological Process: synapsis SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0009560GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0034968GO-bp Annotation by Michelle Graham. GO Biological Process: histone lysine methylation SoyBaseN/AISS
GO:0042138GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic DNA double-strand break formation SoyBaseN/AISS
GO:0045132GO-bp Annotation by Michelle Graham. GO Biological Process: meiotic chromosome segregation SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
KOG2753 KOG Uncharacterized conserved protein, contains PCI domain JGI ISS
PTHR15350Panther COP9 COMPLEX SUBUNIT 7A JGI ISS
PTHR15350:SF2Panther gb def: k08f11.3.p [caenorhabditis elegans] JGI ISS
PF01399PFAM PCI domain JGI ISS
UniRef100_B9T5M0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cop9 complex subunit 7a, putative n=1 Tax=Ricinus communis RepID=B9T5M0_RICCO SoyBaseE_val: 0ISS
UniRef100_I1LWT5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LWT5_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma13g06410
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma13g06410 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g055200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g06410
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g06410
>Glyma13g06410.1   sequence type=CDS   gene model=Glyma13g06410   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACGACGGTGGTGCCCACCTCCGAAGAAGACGCTGCTCTCTCTGTTGTCCGATTCGCCTCTGAACTCGCCTGGGCCGATGCCGGTCCCGAGGTTGCTGAGCCTCAAGTTAGTAGACTCTGCATGGAGGCTGAAGAGTTTATCGTTATGGGAAAATGGTTGGAACTAGCATCATTGATGATTACCTCTGCTGAATTGGTTTTCTCAAAGGTTTCTGAAACAGATATAGAGTCCATCTTCACTATCATCTGCAATCTTGTGACAAAGACTGAGAATCCAGATGAAGTGATGGAGATTGTAAAAGTTATAACTGCAAAAATAATTCAGCAGCCAAACGAAAAGCCTGCTGTGCGATTGAAGACTTTGATCAATCTGTACAATCTTTTGGAGACTCCATACTGCCAGTTTTATGTCTACATGAAGGCATTGAATTTAGCTGTTAATGGGAAAGTCACAGAATACATTATACCTTCATTCAAAAAGATAGATAGCTTCTTGAAAGAGTGGAAAATTGGGATACCTGAACAGAGAGAGCTCTTTCTCACTATCTCTAATATTTTGAAGGAAAATAAAAGCATGTCAAAGGATGCTTTTAAGTTCCTGAGCAATTATCTGTCGACCTTTTCGGGAGAAGATGCACATGTTTTGAGTGAAGCCAAGGAGGAGGCCGCACGTGCAATTGTGGAATTTGTCAGAGCTCCTGACATATATCAGTGTGATTTGCTTGACTTGCCTGCTGTTGGGCAACTGGAGAAGGATGCCAAATATGCTCTGTTATATCAGCTTCTTAAGATTTTTCTTACCCAGAGGCTAGATGCATACTTAGAATATCAAGCTGCAAATTCCACCTTGTTGAAAAACTATGGCCTTGTGCCTGAAGAATGCATTTCCAAAATGAGGCTGATGTCATTGATGGATCTTACCTCTGATGGTTCTGGCCAAATTCCATATGAACTTATTAGGGACACACTTCAGATCAATGATGATGAAGTGGAACTATGGGTGGTTAGAGCAATAACTGCCAAGTTAATTGACTGTAAGATGGACCAAATGCATCAATCAGTAGTTGTTAGTCATCCTACTGATCGTGTGTTTGGTCAGCACCAATGGCAAGCACTGAGAACAAAGCTAGCGACATGGAGAGGAAACATTGCAAATGTTATCAGTACCATTCAGGCCAACAAAATAACGGAGGATGGGTCTCAGGCAGCCCAAGGTTTGGTAGTTAGGTGA
Predicted protein sequences of Glyma13g06410
>Glyma13g06410.1   sequence type=predicted peptide   gene model=Glyma13g06410   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTTVVPTSEEDAALSVVRFASELAWADAGPEVAEPQVSRLCMEAEEFIVMGKWLELASLMITSAELVFSKVSETDIESIFTIICNLVTKTENPDEVMEIVKVITAKIIQQPNEKPAVRLKTLINLYNLLETPYCQFYVYMKALNLAVNGKVTEYIIPSFKKIDSFLKEWKIGIPEQRELFLTISNILKENKSMSKDAFKFLSNYLSTFSGEDAHVLSEAKEEAARAIVEFVRAPDIYQCDLLDLPAVGQLEKDAKYALLYQLLKIFLTQRLDAYLEYQAANSTLLKNYGLVPEECISKMRLMSLMDLTSDGSGQIPYELIRDTLQINDDEVELWVVRAITAKLIDCKMDQMHQSVVVSHPTDRVFGQHQWQALRTKLATWRGNIANVISTIQANKITEDGSQAAQGLVVR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo