SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g05790

Feature Type:gene_model
Chromosome:Gm13
Start:6125482
stop:6128165
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g05790
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G27035AT Annotation by Michelle Graham. TAIR10: early nodulin-like protein 20 | chr2:11535670-11536251 FORWARD LENGTH=163 SoyBaseE_val: 1.00E-36ISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0009055GO-mf Annotation by Michelle Graham. GO Molecular Function: electron carrier activity SoyBaseN/AISS
PF02298PFAM Plastocyanin-like domain JGI ISS
UniRef100_I1LWN9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LWN9_SOYBN SoyBaseE_val: 2.00E-125ISS
UniRef100_Q2HWC7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Blue (Type 1) copper domain n=1 Tax=Medicago truncatula RepID=Q2HWC7_MEDTR SoyBaseE_val: 1.00E-61ISS

Expression Patterns of Glyma13g05790
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g05790
ParalogEvidenceComments
Glyma19g03260 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g05790 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g059700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g05790
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g05790
>Glyma13g05790.1   sequence type=CDS   gene model=Glyma13g05790   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGAATTGGAGGGGTGCTCGGTTGATGGTGGTGGCGAGTGTGGTGGCAATAGGGTGGCTTTCGTTGGTGGTCATGGGAAGTCCGGTGCTTCACAAGGTGGGAGGGTCCAAAGGTTGGATCAATCACGATGTGAACTACACTGAATGGGCTGCTCAAGAGCATGTCTATGTTGGGGATTGGCTCATCTTCAAGTTCGACAGACGATACTTCAACGTTCTGGAGGTGAACAAGACAAGCTACGAGAACTGCATAGACAGGGACTTCATAAAAAACATCACTCGAGGTGGTCGTGACGTGGTGCAAATGACGGAGGCAAGGACCTACTACTACCTCTCCGATGGAGGTTACTGTTTTCATGGTATGAAAGTGGCTGTGCAAGTTCAAGAGTACCAAGATCCCGCACTCGCAATGGTGGCACCAGCTCCTTCCCCCGTCGTGTCTGGTTCTTCTGTGTTCACATGCATTTGGATCATTGTTGCTAATGTTGTGCTTTTTGTGAATTTGATGGTAGTGGGCATTTTGTAA
Predicted protein sequences of Glyma13g05790
>Glyma13g05790.1   sequence type=predicted peptide   gene model=Glyma13g05790   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENWRGARLMVVASVVAIGWLSLVVMGSPVLHKVGGSKGWINHDVNYTEWAAQEHVYVGDWLIFKFDRRYFNVLEVNKTSYENCIDRDFIKNITRGGRDVVQMTEARTYYYLSDGGYCFHGMKVAVQVQEYQDPALAMVAPAPSPVVSGSSVFTCIWIIVANVVLFVNLMVVGIL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo