SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g05640

Feature Type:gene_model
Chromosome:Gm13
Start:5979009
stop:5979776
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g05640
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G52920AT Annotation by Michelle Graham. TAIR10: plastidic pyruvate kinase beta subunit 1 | chr5:21463680-21466612 FORWARD LENGTH=579 SoyBaseE_val: 3.00E-136ISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006629GO-bp Annotation by Michelle Graham. GO Biological Process: lipid metabolic process SoyBaseN/AISS
GO:0006633GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid biosynthetic process SoyBaseN/AISS
GO:0010431GO-bp Annotation by Michelle Graham. GO Biological Process: seed maturation SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0048316GO-bp Annotation by Michelle Graham. GO Biological Process: seed development SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0000287GO-mf Annotation by Michelle Graham. GO Molecular Function: magnesium ion binding SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004743GO-mf Annotation by Michelle Graham. GO Molecular Function: pyruvate kinase activity SoyBaseN/AISS
GO:0030955GO-mf Annotation by Michelle Graham. GO Molecular Function: potassium ion binding SoyBaseN/AISS
PTHR11817Panther PYRUVATE KINASE JGI ISS
PF00224PFAM Pyruvate kinase, barrel domain JGI ISS
UniRef100_I1LWM3UniRef Annotation by Michelle Graham. Best UniRef hit: Pyruvate kinase n=1 Tax=Glycine max RepID=I1LWM3_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1LWM3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Pyruvate kinase n=1 Tax=Glycine max RepID=I1LWM3_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma13g05640
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma13g05640 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g061000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g05640
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g05640
>Glyma13g05640.1   sequence type=CDS   gene model=Glyma13g05640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTATGACTATTAAGTCTAAGACTGAGGATTCTGTGAAATGTGACATTGTTGATGGAGGAGAGCTCAAGTCAAGGAGACTTTTGAATGTTAGAGAAAAAAGTGCAACATTGTCTTCAATCACTAAGAAGGATTGGGATGATATCACATTTGAAGTGGATAACAAAGTTTACTTCTATGTTGCTTCCTTTGTTAAGGATGCTGAATTTGTTCATGAACTAAAGAATTATTTGAAGAGTTGTGGTGTTGATATACATGTCATCGTAAAAATTGAAAGTGCAAACTCTATACCAAATTTGCATACAATTATCACTGCATCTGGTGGCACTATGGTTGTCAGAGGAGATCTTAGCGTTGAGCTCCCTATTGAAGAGGTTCCACTTTTGCAGGAAGAGATAATCAACTTGTGTCGTAACATAGGAAAGGCTATTATTGTGGCAACAAATATGCTAGGCAGCATGATTGTTCACCCAACTCCAACCAGAACAAAGGTATCAAATATAACAACTGTTGTTCGAGAAGGTTCTGATGGAATAATGTTGTCAGGAGAAACAACTCATGGAAAGTTCCTACTAAAAGTTGTGCAAGTAATGCACACAGTAGCATTGCAGACAAAAGCAACTATACTAGGTGGTAAAATTCCACCTAACATTGGTCAAGTGTTGAAGAACTACATGAGTGAGATGTTTGCCTACCACGCAACCATGATGTCTATCACCCTTGGAACCTCAATTATTGTCTTCATTGGAACGGGTTTCATGGCTTAA
Predicted protein sequences of Glyma13g05640
>Glyma13g05640.1   sequence type=predicted peptide   gene model=Glyma13g05640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSMTIKSKTEDSVKCDIVDGGELKSRRLLNVREKSATLSSITKKDWDDITFEVDNKVYFYVASFVKDAEFVHELKNYLKSCGVDIHVIVKIESANSIPNLHTIITASGGTMVVRGDLSVELPIEEVPLLQEEIINLCRNIGKAIIVATNMLGSMIVHPTPTRTKVSNITTVVREGSDGIMLSGETTHGKFLLKVVQVMHTVALQTKATILGGKIPPNIGQVLKNYMSEMFAYHATMMSITLGTSIIVFIGTGFMA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo