Glyma13g04860 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g04860

Feature Type:	gene_model
Chromosome:	Gm13
Start:	5126466
stop:	5127386
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma13g04860

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G28420	AT	Annotation by Michelle Graham. TAIR10: Putative membrane lipoprotein \| chr3:10654674-10655324 REVERSE LENGTH=216	SoyBase	E_val: 3.00E-22	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
UniRef100_I1LWG7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LWG7_SOYBN	SoyBase	E_val: 8.00E-129	ISS

Expression Patterns of Glyma13g04860

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g04860

Paralog	Evidence	Comments
Glyma19g02010	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g04860 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma13g04860

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma13g04860

Limit To All Plant Sequences

>Glyma13g04860.1   sequence type=CDS   gene model=Glyma13g04860   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGATGAAGAGAGAAATTACCAAGGAGGAAGAGCACAAGGAGGATAGCATGCACACTATAGTGTTCACAGCAGGTACATTTCTTCTGATGGTGTGTCTAAAGCACTTTCTAGTTGAGCAGTGGCGTGCTTGGGTGTTCCTCATCCTCAATGTCATTTTGTTAGCTATCCTATTCATGTCTATGAGGCCAGCCAAGTTGGAGGAGGATCACAGTTCAGAAAGTGAAAGCAGTGTTGAAGAAGTGAAAAGTGACAATAAATTAGAGAAAAAGTGGCCAAGTGGGGGGTCTCAAGAAGAAACTGAAAAAGGAAAAGATTGCTACATAAAACAATGTTGTAGTAGTAGTAGTAGTACCTATGCTCTTGTTGAGAATGAAAGAGAAGATGATGAGGAAGAGGAAGAGGAGGAGGAGGAAGAGCAGGTTCCAGTGCTGTCCAAGGAGGAATTGAATGAGAGGGTGGAAGCTTTCATTGCAATGTTTAGGCAGCATTTGATCTCTGATGTCAAACAAGCTGAAAGTTTCAGGCTCCACAAGATTGAAGTGTCTTGCTGTTGA

Predicted protein sequences of Glyma13g04860

Limit To All Plant Sequences

>Glyma13g04860.1   sequence type=predicted peptide   gene model=Glyma13g04860   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEMKREITKEEEHKEDSMHTIVFTAGTFLLMVCLKHFLVEQWRAWVFLILNVILLAILFMSMRPAKLEEDHSSESESSVEEVKSDNKLEKKWPSGGSQEETEKGKDCYIKQCCSSSSSTYALVENEREDDEEEEEEEEEEQVPVLSKEELNERVEAFIAMFRQHLISDVKQAESFRLHKIEVSCC*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain