SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g03185): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g03185): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma13g03185

Feature Type:gene_model
Chromosome:Gm13
Start:3133785
stop:3136584
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G21880AT Annotation by Michelle Graham. TAIR10: lysm domain GPI-anchored protein 1 precursor | chr1:7680689-7682526 FORWARD LENGTH=416 SoyBaseE_val: 4.00E-157ISS
GO:0006955GO-bp Annotation by Michelle Graham. GO Biological Process: immune response SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0016570GO-bp Annotation by Michelle Graham. GO Biological Process: histone modification SoyBaseN/AISS
GO:0016998GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall macromolecule catabolic process SoyBaseN/AISS
GO:0048449GO-bp Annotation by Michelle Graham. GO Biological Process: floral organ formation SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0031225GO-cc Annotation by Michelle Graham. GO Cellular Compartment: anchored to membrane SoyBaseN/AISS
GO:0046658GO-cc Annotation by Michelle Graham. GO Cellular Compartment: anchored to plasma membrane SoyBaseN/AISS
GO:0042834GO-mf Annotation by Michelle Graham. GO Molecular Function: peptidoglycan binding SoyBaseN/AISS
PTHR23354Panther NUCLEOLAR PROTEIN 7/ESTROGEN RECEPTOR COACTIVATOR-RELATED JGI ISS
PTHR23354:SF38Panther JGI ISS
PF01476PFAM LysM domain JGI ISS
UniRef100_G7J302UniRef Annotation by Michelle Graham. Most informative UniRef hit: LysM domain-containing GPI-anchored protein n=1 Tax=Medicago truncatula RepID=G7J302_MEDTR SoyBaseE_val: 2.00E-179ISS
UniRef100_UPI000233BDCAUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233BDCA related cluster n=1 Tax=unknown RepID=UPI000233BDCA SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g03185 not represented in the dataset

Glyma13g03185 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g080700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma13g03185.1   sequence type=CDS   gene model=Glyma13g03185   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGATGCAAATCAACTATAGAGCCATGCTCCAACTATGATTCATGCAATGCTCTTCTTGGCTACACACTTTACACTGACCTCAAGGCCTCTGAGGTTGCTTCTCTCTTTCAAATAGACCCTATTGCACTTCTCACTGCCAATGCCATTGACATCTCTTACCCTGATGTAGAGCACCACATTCTCCCTTCCAAGCTCTTCCTCAAAGTCCCTATCACCCGTTCTTGTGTTGATGGTATTAGAAAATCAATGTCTACTCATTATAGGACTAGACCTTCCGATACTCTCTCTTCCATTGCAAATTCAATATATGGGGGTTTGGTGTCCCCTGATCAGCTTAGGGAGGCTAATTCCATAGGTGATGATCCTTCAGTGCTTGATGTGGGTCTGAACCTTGTGGTGCCACTTCCATGCACTTGCTTCAATGAGAGTGATAACTCTTTGCCTTCAATTTACCTTTCCTATGTGGTTCAGCCAATTGATACATTGGCTGCAATTGCAGCTAGATATTTCACCACTTTTACTGATTTGATGAATGTCAATGACATGGGGACTACAGCTATCTCTGATGGTGACATTCTTGTTGTTCCAATACCTGGTAATTTCTGGGGAAGTGAGGGCATGTTTAATTTGAGAAGTTGTTTTACTTTTTCTTTGCCATTTGATCTACACCATATTACTGCTGGTCACTGTGTGCAGTGTAGCTGTGGACCACAAGATTTGAATTTATACTGTATGCCCTCTTCTCTAGCTGTCTCTTGCTCCAGCATGCGATGCAAAAACAGCAATCTTATGCTTGGGAATGTTACTGTGCAACGAAGTAGTTCTGGTTGCAATGTTACGTCTTGCAATTATGATGGTTTTGTTAGTGGCACCACAATAACATCGTTGTCCCCATCTCTTCAGCCTCGTTGTCCAGGACTGCAGCGATTCCATCCACTTATAGCACCACCTACATCTGTTATAAGGGAATCGGAATTTGCCTTTACACCATCACTATCACCATCACAGTCATCGCAATCACAAGAAACCGGTCTAACAGCTCCTAAGTCTTCGGTCATGCCTGCAACCAGATCATTTCCAGGATTCTCACCTGCAAATGGCCCTGTTAGTAGGATTGCTTCCGGTGCTTCTGCTACTCCCTCCTTGGCAAATCCGATGCTTGTTTTGAGATTTGCATTTATGTTATTGCTTGTAAAGTTGTTGATCCCTTTGGCTTTGTAA

>Glyma13g03185.1   sequence type=predicted peptide   gene model=Glyma13g03185   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRCKSTIEPCSNYDSCNALLGYTLYTDLKASEVASLFQIDPIALLTANAIDISYPDVEHHILPSKLFLKVPITRSCVDGIRKSMSTHYRTRPSDTLSSIANSIYGGLVSPDQLREANSIGDDPSVLDVGLNLVVPLPCTCFNESDNSLPSIYLSYVVQPIDTLAAIAARYFTTFTDLMNVNDMGTTAISDGDILVVPIPGNFWGSEGMFNLRSCFTFSLPFDLHHITAGHCVQCSCGPQDLNLYCMPSSLAVSCSSMRCKNSNLMLGNVTVQRSSSGCNVTSCNYDGFVSGTTITSLSPSLQPRCPGLQRFHPLIAPPTSVIRESEFAFTPSLSPSQSSQSQETGLTAPKSSVMPATRSFPGFSPANGPVSRIASGASATPSLANPMLVLRFAFMLLLVKLLIPLAL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo