SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma13g02550): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma13g02550): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma13g02550

Feature Type:gene_model
Chromosome:Gm13
Start:2424168
stop:2425000
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma13g02550
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G24620AT Annotation by Michelle Graham. TAIR10: EF hand calcium-binding protein family | chr1:8723893-8724453 REVERSE LENGTH=186 SoyBaseE_val: 2.00E-28ISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0048610GO-bp Annotation by Michelle Graham. GO Biological Process: cellular process involved in reproduction SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0048868GO-bp Annotation by Michelle Graham. GO Biological Process: pollen tube development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005509GO-mf Annotation by Michelle Graham. GO Molecular Function: calcium ion binding SoyBaseN/AISS
KOG0027 KOG Calmodulin and related proteins (EF-Hand superfamily) JGI ISS
PTHR10891Panther CALMODULIN JGI ISS
PF10591PFAM Secreted protein acidic and rich in cysteine Ca binding region JGI ISS
UniRef100_G7K6V7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Calmodulin-like protein n=1 Tax=Medicago truncatula RepID=G7K6V7_MEDTR SoyBaseE_val: 4.00E-77ISS
UniRef100_I1LW36UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LW36_SOYBN SoyBaseE_val: 2.00E-105ISS

Expression Patterns of Glyma13g02550
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g02550 not represented in the dataset
Glyma13g02550 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma13g02550 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g083700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma13g02550
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma13g02550
>Glyma13g02550.1   sequence type=CDS   gene model=Glyma13g02550   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCAAGTGGGTTCTCTATCTTCCGAAATGGAGACACTGAATCATGTCCTAGCCCTAGTGGAGGCATTCCGAGCATTTGACGCGGACAACGATGGCCGAATCACGCAGGCAGAGCTAGGAGGAATCTTGGGGTCACTCGGGTACAACCCTAGCGAGCAAGAAGTTAGGGCAATGATTGAACACGGCGACAAGAACAAAGACGGGTTGTTGAGCATCCACGAGTTCTTGGAGATGAACACCAAGGATTTGGAGGGTGGAAATCTCGCCAACACCCTCAGCACCGCGTTTGAGGCTTTGGATGAAGACGGGAACGAGATTTTAACCGGGGAAGAGCTTCATGAGGTCATGCAAAACTTGGGTTTGGACTTGTCTCTTGAGAATTGTGTGCATCTTGTTACTTCTCTTGATGCGGATGGAGATGGGGCTGTGAGCTTGGATGAATTCAGGCTCATAGTCGATTCCCTAATCTAA
Predicted protein sequences of Glyma13g02550
>Glyma13g02550.1   sequence type=predicted peptide   gene model=Glyma13g02550   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAQVGSLSSEMETLNHVLALVEAFRAFDADNDGRITQAELGGILGSLGYNPSEQEVRAMIEHGDKNKDGLLSIHEFLEMNTKDLEGGNLANTLSTAFEALDEDGNEILTGEELHEVMQNLGLDLSLENCVHLVTSLDADGDGAVSLDEFRLIVDSLI*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo