SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT1G35720 | AT | Annotation by Michelle Graham. TAIR10: annexin 1 | chr1:13225304-13226939 FORWARD LENGTH=317 | SoyBase | E_val: 3.00E-167 | ISS |
| GO:0006333 | GO-bp | Annotation by Michelle Graham. GO Biological Process: chromatin assembly or disassembly | SoyBase | N/A | ISS |
| GO:0006816 | GO-bp | Annotation by Michelle Graham. GO Biological Process: calcium ion transport | SoyBase | N/A | ISS |
| GO:0006970 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to osmotic stress | SoyBase | N/A | ISS |
| GO:0006979 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to oxidative stress | SoyBase | N/A | ISS |
| GO:0007030 | GO-bp | Annotation by Michelle Graham. GO Biological Process: Golgi organization | SoyBase | N/A | ISS |
| GO:0009269 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to desiccation | SoyBase | N/A | ISS |
| GO:0009408 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to heat | SoyBase | N/A | ISS |
| GO:0009409 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to cold | SoyBase | N/A | ISS |
| GO:0009414 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to water deprivation | SoyBase | N/A | ISS |
| GO:0009651 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to salt stress | SoyBase | N/A | ISS |
| GO:0009737 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus | SoyBase | N/A | ISS |
| GO:0016126 | GO-bp | Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process | SoyBase | N/A | ISS |
| GO:0019344 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process | SoyBase | N/A | ISS |
| GO:0030003 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cellular cation homeostasis | SoyBase | N/A | ISS |
| GO:0046686 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to cadmium ion | SoyBase | N/A | ISS |
| GO:0070588 | GO-bp | Annotation by Michelle Graham. GO Biological Process: calcium ion transmembrane transport | SoyBase | N/A | ISS |
| GO:0070838 | GO-bp | Annotation by Michelle Graham. GO Biological Process: divalent metal ion transport | SoyBase | N/A | ISS |
| GO:0071435 | GO-bp | Annotation by Michelle Graham. GO Biological Process: potassium ion export | SoyBase | N/A | ISS |
| GO:0005618 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cell wall | SoyBase | N/A | ISS |
| GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
| GO:0005739 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion | SoyBase | N/A | ISS |
| GO:0005773 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: vacuole | SoyBase | N/A | ISS |
| GO:0005774 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane | SoyBase | N/A | ISS |
| GO:0005829 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytosol | SoyBase | N/A | ISS |
| GO:0005886 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane | SoyBase | N/A | ISS |
| GO:0009506 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma | SoyBase | N/A | ISS |
| GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
| GO:0009570 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma | SoyBase | N/A | ISS |
| GO:0009579 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: thylakoid | SoyBase | N/A | ISS |
| GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
| GO:0048046 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: apoplast | SoyBase | N/A | ISS |
| GO:0004601 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: peroxidase activity | SoyBase | N/A | ISS |
| GO:0005507 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: copper ion binding | SoyBase | N/A | ISS |
| GO:0005509 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: calcium ion binding | SoyBase | N/A | ISS |
| GO:0005524 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: ATP binding | SoyBase | N/A | ISS |
| GO:0005544 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: calcium-dependent phospholipid binding | SoyBase | N/A | ISS |
| GO:0008270 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: zinc ion binding | SoyBase | N/A | ISS |
| GO:0042803 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein homodimerization activity | SoyBase | N/A | ISS |
| KOG0819 | KOG | Annexin | JGI | ISS | |
| PTHR10502 | Panther | ANNEXIN | JGI | ISS | |
| PTHR10502:SF10 | Panther | ANNEXIN VII | JGI | ISS | |
| PF00191 | PFAM | Annexin | JGI | ISS | |
| UniRef100_G3E7M9 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Annexin n=2 Tax=Glycine max RepID=G3E7M9_SOYBN | SoyBase | E_val: 0 | ISS |
| UniRef100_G3E7M9 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Annexin n=2 Tax=Glycine max RepID=G3E7M9_SOYBN | SoyBase | E_val: 0 | ISS |
|
Glyma13g01870 not represented in the dataset |
Glyma13g01870 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma14g34740 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.13g088700 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma13g01870.1 sequence type=CDS gene model=Glyma13g01870 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGCGACACTTAAGGTTCCTCAGCCTCTTCCCCCCGTTGCAGATGATTGTGAGCAGCTCCGAAAAGCCTTCTCAGGTTGGGGAACTAACGAGGAGCTGATTGTATCGATCTTGGCTCATAGGAATGCTGCTCAGAGGAAGCTTATCAGAGAAACTTATGCCCAGACCTATGGAGAAGATCTCCTCAAGGCCTTGGACAAAGAACTCACGAGTGATTTTGAGAGGCTGGTTCATCTTTGGACACTTGATTCTGCTGAACGTGATGCATTTTTGGCAAACGAGGCGACTAAAAAATGGACTTCAAGCAATCAGGTTCTGGTGGAAATAGCCTGCACTAGGTCCTCTGAACAATTGTTTGCTGCGAGGAAGGCTTACCATGTTCTTTATAAGAAGTCTCTGGAGGAGGATGTTGCTCATCACACAACAGGAGACTTCCGTAAGCTCATACTACCTCTGGTTAGTTCTTATCGATATGAAGGAGATGAGGTCAACTTGACCCTGGCAAAAACTGAGGCAAAATTGCTGCATGAGAAGATTTCAAACAAGGCTTATAATGATGACGACTTCATCAGGATTTTGGCCACAAGGAGCAGAGCACAGATTAATGCTACTTTGAATCACTACAAAGATGCATTTGGACAAGATATCAACAAGGACCTGAAGGCTGATCCAAAGGACGAGTTCCTGTCTTTACTAAGAGCAACTGTGAAGTGCTTGATCCGTCCCGAGAAGTACTTCGAGAAGGTTGTTCGCTTGGCGATCAACAAGCGAGGAACCGATGAAGGAGCCCTTACAAGAGTGGTGGCCACAAGGGCTGAGGTTGATTTGAAAAACATAGCAGATGAGTATCAAAGGAGGAGCAGTGTCCCTCTTGAACGTGCTATTGTTAAGGACACCACCGGTGACTATGAGAAAATGCTTGTGGCGCTTTTAGGACATGATGATGCTTGA
>Glyma13g01870.1 sequence type=predicted peptide gene model=Glyma13g01870 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MATLKVPQPLPPVADDCEQLRKAFSGWGTNEELIVSILAHRNAAQRKLIRETYAQTYGEDLLKALDKELTSDFERLVHLWTLDSAERDAFLANEATKKWTSSNQVLVEIACTRSSEQLFAARKAYHVLYKKSLEEDVAHHTTGDFRKLILPLVSSYRYEGDEVNLTLAKTEAKLLHEKISNKAYNDDDFIRILATRSRAQINATLNHYKDAFGQDINKDLKADPKDEFLSLLRATVKCLIRPEKYFEKVVRLAINKRGTDEGALTRVVATRAEVDLKNIADEYQRRSSVPLERAIVKDTTGDYEKMLVALLGHDDA*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
