Glyma13g00831 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma13g00831

Feature Type:	gene_model
Chromosome:	Gm13
Start:	531795
stop:	533157
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma13g00831

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G18969	AT	Annotation by Michelle Graham. TAIR10: BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding transcription factors;transcription regulators (TAIR:AT4G30180.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). \| chr2:8229047-8229574 REVERSE LENGTH=175	SoyBase	E_val: 5.00E-23	ISS
UniRef100_D7MC79	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor/ transcription regulator n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7MC79_ARALL	SoyBase	E_val: 3.00E-17	ISS
UniRef100_I1MSP3	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MSP3_SOYBN	SoyBase	E_val: 4.00E-114	ISS

Expression Patterns of Glyma13g00831

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma13g00831 not represented in the dataset	Glyma13g00831 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma13g00831

Paralog	Evidence	Comments
Glyma17g06920	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma13g00831 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.13g098000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma13g00831

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma13g00831

Limit To All Plant Sequences

>Glyma13g00831.1   sequence type=CDS   gene model=Glyma13g00831   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAGGGCAAGTAGTTAAACGCAGACGTGTATACTCCGTGGAATCAAACCAAATAGTGCAACCTATATTTACTAGGAATTATTTGAACCATTTGGTTCCAGCGTTGGTGAAGATAAAGGAAAAGGGTTCTATAAAAGAAGATAGCAGCAGCCATTGTAATGATAATATTAACAATGCTGTCAAGTATGAAGTGGACATGGCAATGGTATTGTCAGCACAAGGTTTTGCATGGAGTAACGGCCTTAAAGTCAAGCTTCAAAGCGATGACGTTCATGTCAATGCAGCTAAAAGCACTAGGTTTCTTGAAAATGAGGCTAGTGAAGGTTCATCGAAGAATAATGTTTATGACAAAAATGAAGTTGTCCCAATGGAATATTTCTCTTCAAACCCTAGCTCAAGGTCTAAGTGCAAGGACATGTCAGAAATGAAAAGGGATTTAGCCAGAGAAGATGATAAGGAAGCTGAGGACATCAACAACCAGTGGAAGAGGCTGAGAAGGATGATACCTGGAGGAGAAGAGATGTGTGATGATGAACAAATGGTTTCAGAGCTTGAGAGTTACATAAACTGTTTGCAAATGCAGGTGAACGCTCTTCAGTTTCTGCTGCCACACACGCGCTGA

Predicted protein sequences of Glyma13g00831

Limit To All Plant Sequences

>Glyma13g00831.1   sequence type=predicted peptide   gene model=Glyma13g00831   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGGQVVKRRRVYSVESNQIVQPIFTRNYLNHLVPALVKIKEKGSIKEDSSSHCNDNINNAVKYEVDMAMVLSAQGFAWSNGLKVKLQSDDVHVNAAKSTRFLENEASEGSSKNNVYDKNEVVPMEYFSSNPSSRSKCKDMSEMKRDLAREDDKEAEDINNQWKRLRRMIPGGEEMCDDEQMVSELESYINCLQMQVNALQFLLPHTR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain