SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma13g00310

Feature Type:gene_model
Chromosome:Gm13
Start:76927
stop:78778
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G60390AT Annotation by Michelle Graham. TAIR10: homeobox-leucine zipper protein 3 | chr3:22320788-22322370 REVERSE LENGTH=315 SoyBaseE_val: 4.00E-47ISS
GO:0006351GO-bp Annotation by Michelle Graham. GO Biological Process: transcription, DNA-dependent SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0043565GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding SoyBaseN/AISS
PTHR24326Panther FAMILY NOT NAMED JGI ISS
PTHR24326:SF218Panther JGI ISS
PF00046PFAM Homeobox domain JGI ISS
PF02183PFAM Homeobox associated leucine zipper JGI ISS
UniRef100_G7JT79UniRef Annotation by Michelle Graham. Most informative UniRef hit: Homeobox-leucine zipper protein n=1 Tax=Medicago truncatula RepID=G7JT79_MEDTR SoyBaseE_val: 1.00E-68ISS
UniRef100_I1LVK0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LVK0_SOYBN SoyBaseE_val: 1.00E-152ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma17g06380 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.13g102800 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma13g00310.1   sequence type=CDS   gene model=Glyma13g00310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGACAATAATGAAGAATGCATCACTGGGTTATGTTTGGGAATTGGAATGGGAGGGCATGTTCCAAAGAAGAATAAGCAGAAAGAGAACAAGGCTGTGGCTTGCCTAGACCTAGCGTTTGAGCTTTGTCCAAAAGGAGAAGAAGCCATTAACGTGAATCTTCATCATCATCATCATGAGAAGGTAGAAAGAATCAGCTTGGAGAGAATCCACGAGTACCCCAATGAAAAGAGCACTGATTCTGATAACAGCAACAACAACAACAGATGCAGAAAGAAACTGCGGCTTTCCAAGGAGCAATCATCCATGCTTGAGAACAGCTTCAAACAGCATAGCACTCTTAATCCGGTCCAGAAACAAGCACTAGCTGATCAATTGAATTTAAAGACTAGACAAGTTGAAGTTTGGTTTCAGAACAGAAGAGCAAGGACCAAACTGAAGCAGACAGAAGTGGACCACGAGTTGTTGAAAAAACACTGTCAAAATCTAAGTGATGAGAACAAAAGATTGAAGAAGGAATTGCAGGAACTACGTGCACTTAAGGTTGGACCGTCGCCACTATGCATTCAACTATCCAAAACGGCGACTCTGACAACTATGTGTTCTTCCTGCGATCGAGAATTAAAACTAGTAAATTAA

>Glyma13g00310.1   sequence type=predicted peptide   gene model=Glyma13g00310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEDNNEECITGLCLGIGMGGHVPKKNKQKENKAVACLDLAFELCPKGEEAINVNLHHHHHEKVERISLERIHEYPNEKSTDSDNSNNNNRCRKKLRLSKEQSSMLENSFKQHSTLNPVQKQALADQLNLKTRQVEVWFQNRRARTKLKQTEVDHELLKKHCQNLSDENKRLKKELQELRALKVGPSPLCIQLSKTATLTTMCSSCDRELKLVN*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo