Glyma12g36970 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma12g36970

Feature Type:	gene_model
Chromosome:	Gm12
Start:	39971883
stop:	39973514
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma12g36970

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G61760	AT	Annotation by Michelle Graham. TAIR10: inositol polyphosphate kinase 2 beta \| chr5:24813916-24814818 REVERSE LENGTH=300	SoyBase	E_val: 4.00E-103	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0006626	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to mitochondrion	SoyBase	N/A	ISS
GO:0010264	GO-bp	Annotation by Michelle Graham. GO Biological Process: myo-inositol hexakisphosphate biosynthetic process	SoyBase	N/A	ISS
GO:0042732	GO-bp	Annotation by Michelle Graham. GO Biological Process: D-xylose metabolic process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0000823	GO-mf	Annotation by Michelle Graham. GO Molecular Function: inositol-1,4,5-trisphosphate 6-kinase activity	SoyBase	N/A	ISS
GO:0008440	GO-mf	Annotation by Michelle Graham. GO Molecular Function: inositol-1,4,5-trisphosphate 3-kinase activity	SoyBase	N/A	ISS
GO:0051765	GO-mf	Annotation by Michelle Graham. GO Molecular Function: inositol tetrakisphosphate kinase activity	SoyBase	N/A	ISS
GO:0051766	GO-mf	Annotation by Michelle Graham. GO Molecular Function: inositol trisphosphate kinase activity	SoyBase	N/A	ISS
GO:0052725	GO-mf	Annotation by Michelle Graham. GO Molecular Function: inositol-1,3,4-trisphosphate 6-kinase activity	SoyBase	N/A	ISS
KOG1620	KOG	Inositol polyphosphate multikinase, component of the ARGR transcription regulatory complex	JGI		ISS
PTHR12400	Panther	INOSITOL POLYPHOSPHATE KINASE	JGI		ISS
PTHR12400:SF2	Panther	INOSITOL HEXAKISPHOSPHATE KINASE-RELATED	JGI		ISS
PF03770	PFAM	Inositol polyphosphate kinase	JGI		ISS
UniRef100_A7X649	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Inositol polyphosphate 6-/3-/5-kinase n=1 Tax=Glycine max RepID=A7X649_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_A7X649	UniRef	Annotation by Michelle Graham. Best UniRef hit: Inositol polyphosphate 6-/3-/5-kinase n=1 Tax=Glycine max RepID=A7X649_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma12g36970

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma12g36970 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.12g240900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma12g36970

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma12g36970

Limit To All Plant Sequences

>Glyma12g36970.1   sequence type=CDS   gene model=Glyma12g36970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTCAAGATCCCGGAGCACCAGGTGGCCGGGCACAAGGCCAAGGACGGAATCCTGGGCCCACTCGTCGACGATTTTGGAAAATTCTACAAGCCCCTCCAGACCAACAAAGACGACGACACCCGCGGCTCCACCGAACTCTCCTTTTACACCTCTCTCGCCGCCGCCGCCCACGACTACTCCATCCGCTCCTTCTTCCCCGCCTTTCACGGCACCCGCCTCCTGGACGCCTCCGACGGCTCCGGTCCCCACCCTCACCTGGTCCTGGAGGACCTCCTCTGCGGCTACTCCAAACCCTCCGTCATGGACGTAAAGATCGGCTCCAGAACCTGGCACCTGGGAGACTCCGAGGACTACATCTGCAAGTGCCTGAAGAAGGACAGAGAGTCCTCTAGCTTGCCCTTGGGTTTCAGAATCTCGGGAGTCAAGGACTCTATCTCCTCCTGGGAACCTACCAGGAAATCTCTCCAGTGTCTATCCGCCCATGGTGTTGCACTTGTTCTCAACAAGTTCGTTTCCTCTAATAATATCAACCATGATGATCATCATCCCGATTGCGCTTTCGCAACGGAGGTCTACGGCGCCGTTTTGGAGCGCTTGCAGAAGCTCAAGGACTGGTTCGAGGTTCAGACGGTGTATCACTTCTATTCTTGTTCTGTTCTTGTGGTGTACGAGAAGGATCTAGGGAAAGGGAAAGCTACCAACCCTCTGGTCAAACTCGTTGACTTTGCACACGTGGTGGACGGAAACGGTGTCATTGATCACAACTTCTTGGGTGGCCTTTGTTCCTTCATCAAGTTCCTCAAGGATATCCTAGCAGTAGCATGTCTTCACAAGTGA

Predicted protein sequences of Glyma12g36970

Limit To All Plant Sequences

>Glyma12g36970.1   sequence type=predicted peptide   gene model=Glyma12g36970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLKIPEHQVAGHKAKDGILGPLVDDFGKFYKPLQTNKDDDTRGSTELSFYTSLAAAAHDYSIRSFFPAFHGTRLLDASDGSGPHPHLVLEDLLCGYSKPSVMDVKIGSRTWHLGDSEDYICKCLKKDRESSSLPLGFRISGVKDSISSWEPTRKSLQCLSAHGVALVLNKFVSSNNINHDDHHPDCAFATEVYGAVLERLQKLKDWFEVQTVYHFYSCSVLVVYEKDLGKGKATNPLVKLVDFAHVVDGNGVIDHNFLGGLCSFIKFLKDILAVACLHK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain