Glyma12g35970 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma12g35970): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma12g35970): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma12g35970

Feature Type:	gene_model
Chromosome:	Gm12
Start:	39067900
stop:	39071779
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma12g35970

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G16920	AT	Annotation by Michelle Graham. TAIR10: RAB GTPase homolog A1B \| chr1:5787489-5789147 REVERSE LENGTH=216	SoyBase	E_val: 7.00E-140	ISS
GO:0006886	GO-bp	Annotation by Michelle Graham. GO Biological Process: intracellular protein transport	SoyBase	N/A	ISS
GO:0016192	GO-bp	Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport	SoyBase	N/A	ISS
GO:0042538	GO-bp	Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005773	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuole	SoyBase	N/A	ISS
GO:0005774	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane	SoyBase	N/A	ISS
GO:0005802	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: trans-Golgi network	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0003924	GO-mf	Annotation by Michelle Graham. GO Molecular Function: GTPase activity	SoyBase	N/A	ISS
GO:0005525	GO-mf	Annotation by Michelle Graham. GO Molecular Function: GTP binding	SoyBase	N/A	ISS
KOG0087	KOG	GTPase Rab11/YPT3, small G protein superfamily	JGI		ISS
PTHR24073	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24073:SF213	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF00071	PFAM	Ras family	JGI		ISS
UniRef100_C6TM07	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TM07_SOYBN	SoyBase	E_val: 2.00E-156	ISS
UniRef100_Q08150	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: GTP-binding protein n=2 Tax=Fabeae RepID=Q08150_PEA	SoyBase	E_val: 6.00E-153	ISS

Expression Patterns of Glyma12g35970

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g35970 not represented in the dataset	Glyma12g35970 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma12g35970

Paralog	Evidence	Comments
Glyma13g34410	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma12g35970 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.12g230600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma12g35970

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma12g35970

Limit To All Plant Sequences

>Glyma12g35970.1   sequence type=CDS   gene model=Glyma12g35970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGGGTTACAGAGCCGACGACGACTACGACTACCTCTTCAAGGTGGTCCTCATCGGCGACTCCGGCGTGGGCAAGTCCAACCTCCTCTCGCGCTTCACCAAGAACGAGTTCAACCTGGAGTCCAAGTCCACCATTGGCGTCGAGTTCGCCACCCGCACCTTGAACGTCGATTCCAAAGTCATCAAGGCCCAGATCTGGGATACCGCAGGCCAAGAAAGGTATCGTGCGATCACCAGTGCTTACTATCGTGGGGCAGTTGGTGCACTTCTTGTGTATGATGTCACTCGCCATGCAACATTTGAAAATGTTGACAGATGGCTGAAAGAATTGCGGAACCACACAGACGCCAACATTGTTGTGATGCTAGTTGGCAACAAATCAGACCTTCGTCACCTCGTAGCGGTGTCAACTGAAGATGGGAAGTCCTATGCTGAGAAAGAATCACTTTACTTCATGGAAACCTCAGCTCTGGAGGCTACTAATGTAGAGAATGCATTTGCTGAAGTTCTGACTCAAATCTACCGCATTGTTAGCAAGAAAGCAGTAGAGGGGGCTGAAAATGGAACTGCATCTGTGCCTGCCAAAGGAGAGAAAATTGATCTGAAAAATGATGTGTCTGCTTTGAAGAGAGTTGGTTGCTGCTCAAGCTAA

Predicted protein sequences of Glyma12g35970

Limit To All Plant Sequences

>Glyma12g35970.1   sequence type=predicted peptide   gene model=Glyma12g35970   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAGYRADDDYDYLFKVVLIGDSGVGKSNLLSRFTKNEFNLESKSTIGVEFATRTLNVDSKVIKAQIWDTAGQERYRAITSAYYRGAVGALLVYDVTRHATFENVDRWLKELRNHTDANIVVMLVGNKSDLRHLVAVSTEDGKSYAEKESLYFMETSALEATNVENAFAEVLTQIYRIVSKKAVEGAENGTASVPAKGEKIDLKNDVSALKRVGCCSS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain