SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma12g33640

Feature Type:gene_model
Chromosome:Gm12
Start:36852431
stop:36855916
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma12g33640
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G15030AT Annotation by Michelle Graham. TAIR10: TCP family transcription factor 4 | chr3:5062308-5063570 FORWARD LENGTH=420 SoyBaseE_val: 4.00E-68ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006417GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of translation SoyBaseN/AISS
GO:0009657GO-bp Annotation by Michelle Graham. GO Biological Process: plastid organization SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0016226GO-bp Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0045962GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of development, heterochronic SoyBaseN/AISS
GO:0048366GO-bp Annotation by Michelle Graham. GO Biological Process: leaf development SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
PF03634PFAM TCP family transcription factor JGI ISS
UniRef100_G7ZVJ2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor PCF5 n=2 Tax=Medicago truncatula RepID=G7ZVJ2_MEDTR SoyBaseE_val: 8.00E-148ISS
UniRef100_UPI000233C73AUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233C73A related cluster n=1 Tax=unknown RepID=UPI000233C73A SoyBaseE_val: 0ISS

Expression Patterns of Glyma12g33640
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma12g33640
ParalogEvidenceComments
Glyma13g36840 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma12g33640 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g208800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma12g33640
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma12g33640
>Glyma12g33640.1   sequence type=CDS   gene model=Glyma12g33640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGCATGAAGAGCACTGGGGGAGAGATTGTTCAAGTCCAAGGAGGGCACATTGTTCGGTCCACAGGTAGAAAAGATAGGCACAGCAAGGTTTACACTGCAAAGGGTCCTCGTGATCGAAGGGTTAGGCTCTCAGCACACACTGCTATTGAGTTCTATGATGTTCAAGATCGTTTAGGCTATGACAGACCAAGCAAAGCCGTGGACTGGCTCATCAAGAAGGCCAAGAATGCTATTGATAAGCTTGGTGAGCTTCCTCCATGGCACCCTACTCCTAACACTGCTGCAGATGCTGAGAACAACAACAACAACAACAATGCAGGGTCAAGTGACATGGCCATTGCAGCAGAACAATCTGAGTCTTCTGGTTACAATTTTCAGCTGCAAAGGCAATTAGGTGAGGACCATGATAACCACCATTCGGCTTTCATTCCCTCACCTATTGACACTGATGCAATAGCCTTCTTTCCAACAACCACTGCAACCTCCTCCATCAATTTCCAAACCTACCCTCCTAATATAATCTCAAGAACCAACAACTCCACTGAGGATCTTGGCCTTTCCCTTCACTCCTTCCAAGACCCTGGTTTGATTCATGGCCAGACCCAAGCAGGTGCAAACCAGACACAAACACCTTCCAATGACCAAAGCCTCTTCTCTGGCTCAACTCAAGTGGGGTTTGAGGCCAATTACCCCAGGATTGTCACTTGGAACAGTGATGCAAGCATAGATATGAACAGAACCGGGTTCATGGTCAATTCACCAGCACTTCTAGGCCAAGGTGGTTCTGCTGCATTTTCCCAAAGGGGGACCCTTCAGTCCAGTTTCTCACCATCACTTCGTCCTTGGAGTGAGATTCCAATGGCTTCATCAGAACATCACAAGTCACAGCCAATTCAACAAGCTTCAATCTTTGGCAGCAGGTTTCTGTCTGATGCATTGCCGGGGTTCTGCATTCCTGCTAGAATCCAAGGAGAGGATGGAGTTGGTCCTGACAAGCCATCATCTTCTTCTCCTAATTCTCATCACTGA
Predicted protein sequences of Glyma12g33640
>Glyma12g33640.1   sequence type=predicted peptide   gene model=Glyma12g33640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGMKSTGGEIVQVQGGHIVRSTGRKDRHSKVYTAKGPRDRRVRLSAHTAIEFYDVQDRLGYDRPSKAVDWLIKKAKNAIDKLGELPPWHPTPNTAADAENNNNNNNAGSSDMAIAAEQSESSGYNFQLQRQLGEDHDNHHSAFIPSPIDTDAIAFFPTTTATSSINFQTYPPNIISRTNNSTEDLGLSLHSFQDPGLIHGQTQAGANQTQTPSNDQSLFSGSTQVGFEANYPRIVTWNSDASIDMNRTGFMVNSPALLGQGGSAAFSQRGTLQSSFSPSLRPWSEIPMASSEHHKSQPIQQASIFGSRFLSDALPGFCIPARIQGEDGVGPDKPSSSSPNSHH*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo