SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma12g33400): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma12g33400): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma12g33400

Feature Type:gene_model
Chromosome:Gm12
Start:36684712
stop:36688692
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G44200AT Annotation by Michelle Graham. TAIR10: CAP-binding protein 20 | chr5:17802062-17803875 REVERSE LENGTH=257 SoyBaseE_val: 2.00E-131ISS
GO:0000394GO-bp Annotation by Michelle Graham. GO Biological Process: RNA splicing, via endonucleolytic cleavage and ligation SoyBaseN/AISS
GO:0000398GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA splicing, via spliceosome SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006366GO-bp Annotation by Michelle Graham. GO Biological Process: transcription from RNA polymerase II promoter SoyBaseN/AISS
GO:0009086GO-bp Annotation by Michelle Graham. GO Biological Process: methionine biosynthetic process SoyBaseN/AISS
GO:0016070GO-bp Annotation by Michelle Graham. GO Biological Process: RNA metabolic process SoyBaseN/AISS
GO:0030422GO-bp Annotation by Michelle Graham. GO Biological Process: production of siRNA involved in RNA interference SoyBaseN/AISS
GO:0031053GO-bp Annotation by Michelle Graham. GO Biological Process: primary miRNA processing SoyBaseN/AISS
GO:0035196GO-bp Annotation by Michelle Graham. GO Biological Process: production of miRNAs involved in gene silencing by miRNA SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005845GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mRNA cap binding complex SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0000339GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA cap binding SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG0121 KOG Nuclear cap-binding protein complex, subunit CBP20 (RRM superfamily) JGI ISS
PTHR18847Panther 20 KD NUCLEAR CAP BINDING PROTEIN JGI ISS
PF00076PFAM RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) JGI ISS
UniRef100_B9RVU5UniRef Annotation by Michelle Graham. Most informative UniRef hit: 20 kD nuclear cap binding protein, putative n=1 Tax=Ricinus communis RepID=B9RVU5_RICCO SoyBaseE_val: 2.00E-144ISS
UniRef100_I1LUI7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LUI7_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g33400 not represented in the dataset

Glyma12g33400 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma13g37030 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g206400 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma12g33400.1   sequence type=CDS   gene model=Glyma12g33400   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCTGTTATTCAAGGATCCGTCGAAGATTTCGGCGTATCGAGATAGAAGGTTCCCCGGGACGCAAGAGGAGTTTGAGCACGCGCTTCTGACCTCAACCACCGTTTACGTGGGGAACATGTCGTTTTACACGACGGAGGAGCAAGTTTACGAGCTCTTCTCGCGTGCTGGGGAAATCAAAAAGATCATCATGGGCTTGGACAAGAACACAAAAACGCCTTGCGGCTTCTGTTTCGTTTTATATTATTCTCGTGAAGATACTGAGGATGTTTGCAAATACATAAGTGGGACGATACTGGATGATCGTCCCATTCGAGTTGATTTTGATTGGGGATTTCAGGATGGTAGACAATGGGGGCGTGGGAGGAGTGGTGGCCAGGTCCGTGACGAATATCGCACTGATTATGATCCTGGTAGAGGTGGCTATGGGAAGCTGGTTCAGAAAGAATTAGAAGTACAAAGGCAGCTTGTAGATTATGGCACTGGTTCTTTGGGTTCTTTTCCACCAGTTATTCCAACTTCCTATGGTAGACATGGTGGAGGTCATGGTCATGGTGGTTCCCATCGACATGGTAGAGATTACTATAGGAAGAGACACCGAGATGATGACCGCCACATACACGAGTCCTCAAAAAGAAATTCTGATCATGAATCTCGGAGGAACACTGACCACGAATCCAGACCGGAAAAAAATCCACGGTTTCGTGAGAGTGGTGATTCTGATGATGACGAGGAAGATGATAGAAAAAGACGGGCTTAA

>Glyma12g33400.1   sequence type=predicted peptide   gene model=Glyma12g33400   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALLFKDPSKISAYRDRRFPGTQEEFEHALLTSTTVYVGNMSFYTTEEQVYELFSRAGEIKKIIMGLDKNTKTPCGFCFVLYYSREDTEDVCKYISGTILDDRPIRVDFDWGFQDGRQWGRGRSGGQVRDEYRTDYDPGRGGYGKLVQKELEVQRQLVDYGTGSLGSFPPVIPTSYGRHGGGHGHGGSHRHGRDYYRKRHRDDDRHIHESSKRNSDHESRRNTDHESRPEKNPRFRESGDSDDDEEDDRKRRA*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo