SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma12g31960

Feature Type:gene_model
Chromosome:Gm12
Start:35514880
stop:35517609
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma12g31960
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G16970AT Annotation by Michelle Graham. TAIR10: alkenal reductase | chr5:5576291-5578001 REVERSE LENGTH=345 SoyBaseE_val: 3.00E-72ISS
GO:0006865GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid transport SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0009407GO-bp Annotation by Michelle Graham. GO Biological Process: toxin catabolic process SoyBaseN/AISS
GO:0010583GO-bp Annotation by Michelle Graham. GO Biological Process: response to cyclopentenone SoyBaseN/AISS
GO:0015824GO-bp Annotation by Michelle Graham. GO Biological Process: proline transport SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016747GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring acyl groups other than amino-acyl groups SoyBaseN/AISS
GO:0032440GO-mf Annotation by Michelle Graham. GO Molecular Function: 2-alkenal reductase [NAD(P)] activity SoyBaseN/AISS
KOG1196 KOG Predicted NAD-dependent oxidoreductase JGI ISS
PTHR11695Panther ALCOHOL DEHYDROGENASE RELATED JGI ISS
PTHR11695:SF5Panther BENZYLALCOHOL DEHYDROGENASE JGI ISS
PF00107PFAM Zinc-binding dehydrogenase JGI ISS
UniRef100_B9SUK8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Alcohol dehydrogenase, putative n=1 Tax=Ricinus communis RepID=B9SUK8_RICCO SoyBaseE_val: 4.00E-128ISS
UniRef100_C6TKH5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TKH5_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma12g31960
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma12g31960
ParalogEvidenceComments
Glyma13g38510 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma12g31960 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g193400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma12g31960
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma12g31960
>Glyma12g31960.1   sequence type=CDS   gene model=Glyma12g31960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTGAAGAGGTGAAAAGCTTGGTTGTTGAAGAGGAAATGGGGGTGGTGGAAAGCAAAGAATGGTACTTGGTATCTTATGCTCCACACGGTGTTCCAACCACCGATCATCTTAAACTCCGCAAGGTTCGTCTATCAATTGCACCTGAATCAATCCCTGACGCCCATGTTGCCATTGAGATGCTGCTTTTCTCTGTAGATCCATATCTTCGAGGCAGATTCACTGGAACCTTAGATGGCCTTTATTTTCCGCAGTTTGAACTCAACCAGGTGATCACAATATTTGGGATTGGAAGAGTGAAACGATCAAATGACAGTAAATATGAAGAGGGAGATATTGTTTTGAGTGCAAGTTTTCCTGTTGCTGAGTATTGTGTGATGCCCTCCAGTGAGATCGATGCAAAAATTGATGCTGCAAGTGGGATTTCATTGCCGGATTATCTGAGCACTCTAGGAGTGCCTGGATTTGCAGCATGGCTGGGGATAGAGGTGGTGGCAGACCCCAAACCTGGTTCAAATGTGTTCATATCTGCAGCTTCAGGTGGTGTGGGAATGATTGCTGGTCAATTGGCTAAGATCAGAGGTTGTAGGGTCATCGGAAGCACGGGATCTGATGAAAAAGTGAGGCTAATCAAAGAGGAATTTGGGTATGATGATGGATTCAACTACAAAAAGGAAGAGGACCTTGATGCAGTTCTAAGCAAGTTCTTTCCTAATGGTATTGATGTTTACCTTGACAATGTTGGCGGGAAGATGCTTGAATCTGTACTGAATCATGTCAACAAGTTTGCCAGGATACCACTTTGCGGGATGATATCTCAATATAACCAGGCTTGGACAGAAAGAGAAGGCGTCAGGAATCTTTTGAATTTGGTGGGCAAGGAAGTAAGAATGGAAGGGTTTTTGCTGAAAACACATTTCAATCGTTTTGGAGACTTTGCAAAAGAGATTGAGGGCCACATAAAAGAAGGGAGGCTTAAGCCCAAGACTAAAATAAACTTCGGAATTGAGAGCTTTTTGGATAGCTTGAACTCCTTGTTTTCTAGCTCTAATATTGGAAAAGTAGTTATTCAAGTTAATAAGGCTTAA
Predicted protein sequences of Glyma12g31960
>Glyma12g31960.1   sequence type=predicted peptide   gene model=Glyma12g31960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGEEVKSLVVEEEMGVVESKEWYLVSYAPHGVPTTDHLKLRKVRLSIAPESIPDAHVAIEMLLFSVDPYLRGRFTGTLDGLYFPQFELNQVITIFGIGRVKRSNDSKYEEGDIVLSASFPVAEYCVMPSSEIDAKIDAASGISLPDYLSTLGVPGFAAWLGIEVVADPKPGSNVFISAASGGVGMIAGQLAKIRGCRVIGSTGSDEKVRLIKEEFGYDDGFNYKKEEDLDAVLSKFFPNGIDVYLDNVGGKMLESVLNHVNKFARIPLCGMISQYNQAWTEREGVRNLLNLVGKEVRMEGFLLKTHFNRFGDFAKEIEGHIKEGRLKPKTKINFGIESFLDSLNSLFSSSNIGKVVIQVNKA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo