SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma12g30780): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma12g30780): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma12g30780

Feature Type:gene_model
Chromosome:Gm12
Start:34416244
stop:34422162
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma12g30780
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G44600AT Annotation by Michelle Graham. TAIR10: cyclophilin71 | chr3:16165368-16169201 REVERSE LENGTH=631 SoyBaseE_val: 0ISS
GO:0000003GO-bp Annotation by Michelle Graham. GO Biological Process: reproduction SoyBaseN/AISS
GO:0000085GO-bp Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle SoyBaseN/AISS
GO:0003002GO-bp Annotation by Michelle Graham. GO Biological Process: regionalization SoyBaseN/AISS
GO:0006306GO-bp Annotation by Michelle Graham. GO Biological Process: DNA methylation SoyBaseN/AISS
GO:0006310GO-bp Annotation by Michelle Graham. GO Biological Process: DNA recombination SoyBaseN/AISS
GO:0006312GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic recombination SoyBaseN/AISS
GO:0006325GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin organization SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006396GO-bp Annotation by Michelle Graham. GO Biological Process: RNA processing SoyBaseN/AISS
GO:0006406GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA export from nucleus SoyBaseN/AISS
GO:0006457GO-bp Annotation by Michelle Graham. GO Biological Process: protein folding SoyBaseN/AISS
GO:0006606GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into nucleus SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0007155GO-bp Annotation by Michelle Graham. GO Biological Process: cell adhesion SoyBaseN/AISS
GO:0009560GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0009887GO-bp Annotation by Michelle Graham. GO Biological Process: organ morphogenesis SoyBaseN/AISS
GO:0009888GO-bp Annotation by Michelle Graham. GO Biological Process: tissue development SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010014GO-bp Annotation by Michelle Graham. GO Biological Process: meristem initiation SoyBaseN/AISS
GO:0010073GO-bp Annotation by Michelle Graham. GO Biological Process: meristem maintenance SoyBaseN/AISS
GO:0010074GO-bp Annotation by Michelle Graham. GO Biological Process: maintenance of meristem identity SoyBaseN/AISS
GO:0010082GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of root meristem growth SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010305GO-bp Annotation by Michelle Graham. GO Biological Process: leaf vascular tissue pattern formation SoyBaseN/AISS
GO:0010332GO-bp Annotation by Michelle Graham. GO Biological Process: response to gamma radiation SoyBaseN/AISS
GO:0010338GO-bp Annotation by Michelle Graham. GO Biological Process: leaf formation SoyBaseN/AISS
GO:0010358GO-bp Annotation by Michelle Graham. GO Biological Process: leaf shaping SoyBaseN/AISS
GO:0010638GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of organelle organization SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0016570GO-bp Annotation by Michelle Graham. GO Biological Process: histone modification SoyBaseN/AISS
GO:0016571GO-bp Annotation by Michelle Graham. GO Biological Process: histone methylation SoyBaseN/AISS
GO:0016579GO-bp Annotation by Michelle Graham. GO Biological Process: protein deubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0031047GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing by RNA SoyBaseN/AISS
GO:0031060GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of histone methylation SoyBaseN/AISS
GO:0032204GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of telomere maintenance SoyBaseN/AISS
GO:0033043GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of organelle organization SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0043247GO-bp Annotation by Michelle Graham. GO Biological Process: telomere maintenance in response to DNA damage SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045010GO-bp Annotation by Michelle Graham. GO Biological Process: actin nucleation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048440GO-bp Annotation by Michelle Graham. GO Biological Process: carpel development SoyBaseN/AISS
GO:0048443GO-bp Annotation by Michelle Graham. GO Biological Process: stamen development SoyBaseN/AISS
GO:0048449GO-bp Annotation by Michelle Graham. GO Biological Process: floral organ formation SoyBaseN/AISS
GO:0048451GO-bp Annotation by Michelle Graham. GO Biological Process: petal formation SoyBaseN/AISS
GO:0048453GO-bp Annotation by Michelle Graham. GO Biological Process: sepal formation SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0080008GO-cc Annotation by Michelle Graham. GO Cellular Compartment: CUL4-RING ubiquitin ligase complex SoyBaseN/AISS
GO:0003682GO-mf Annotation by Michelle Graham. GO Molecular Function: chromatin binding SoyBaseN/AISS
GO:0003755GO-mf Annotation by Michelle Graham. GO Molecular Function: peptidyl-prolyl cis-trans isomerase activity SoyBaseN/AISS
GO:0042393GO-mf Annotation by Michelle Graham. GO Molecular Function: histone binding SoyBaseN/AISS
KOG0882 KOG Cyclophilin-related peptidyl-prolyl cis-trans isomerase JGI ISS
PTHR11071Panther CYCLOPHILIN JGI ISS
PTHR11071:SF40Panther PEPTIDYL-PROLYL CIS-TRANS ISOMERASE-LIKE JGI ISS
PF00160PFAM Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD JGI ISS
PF00400PFAM WD domain, G-beta repeat JGI ISS
UniRef100_B9SSV2UniRef Annotation by Michelle Graham. Most informative UniRef hit: WD-repeat protein, putative n=1 Tax=Ricinus communis RepID=B9SSV2_RICCO SoyBaseE_val: 0ISS
UniRef100_I1LTT0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LTT0_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma12g30780
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g30780 not represented in the dataset
Glyma12g30780 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma12g30780
ParalogEvidenceComments
Glyma13g39500 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma12g30780 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g182700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma12g30780
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma12g30780
>Glyma12g30780.1   sequence type=CDS   gene model=Glyma12g30780   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACGGAGGAACACGAGAATGGCGCCAACGCAAGCGAGGAGGAACAGGTCATAGGCCCGGGCCCGGCCCCTCGTGCCCGGCCCAAGCGACCCCTTCAGTTCGAGCACGCCTACCTCGACGCCTTACCCTCTGCCAACATGTACGAGAAAAGTTATATGCACCGTGATGTGGTTACGCATGTCGCTGTTTCAGCTGCCGAATTTTTCATCACTGGAAGTGCCGATGGTCATTTGAAGTTTTGGAAGAAAAGGCCTATTGGTATTGAGTTTGCCAAGCACTTCAGATCTCATCTTGGTCCAATTGAAGGTCTAGCTGTTAGTATTGATGGTCTGCTTTGCTGTACAATATCAAATGACCGCTCTGTGAAAATATATGACGTAGTCAACTTTGACATGATGGTCATGATTCGCTTGCCATATGTTCCTGGTGCTGTTGAATGGGTTTACAAACAAGGGGATGTCAAAGCTAGGCTAGCCATTAGTGATAGGAACTCATCTTTTGTGCACATATATGATGCAAGGGCTGGTACAAATGATCCTATCATCTCCAAAGAGATACATATGGGTCCTATTAAAGTTATGAAGTACAATCCTGTATGTGATTCTGTACTTTCGGCAGATGCAAAGGGGATAATTGAATACTGGAGCCCTGCTACACTTCAATTCCCAGAGAATGTGGTCGATTTTAAATTGAAAAGTGACACTAACCTCTTTGAAATTGCAAAATGCAAGACTTCTGTTTCGGCTATTGAGGTTAGTCCAGATGGTAAGCAATTTTCCATTACATCACCTGATCGGAGAATACGTGTGTTTTGGTTCAGTACAGGTAAACTAAGGCGAGTTTATGATGAATCCCTGGAGGTTGCTCAAGATCTCCAAAGAAGTGATGCTCCATTATACCGGTTGGAAGCCATTGATTTTGGTCGAAGAATGGCTGTCGAGAAGGAAATAGAGAAGACAGAAAGTGCACTACTTCCAAATGCAGTTTTTGACGAAAGTTCCAATTTTCTTATATATGCAACCTTGCTTGGGATTAAAATTGTTAATCTGCACACCAATAAAGTTGCTCGAATACTTGGAAAGGTGGAGAATAATGATAGGTTCTTAAGAATAGCTTTATATCAAGGGGATCGAAATAGTAAAAAAGTAAGAAAGATCCCTTCAGCAGCTGCAAATGCTAATGAGAGCAAGGAGCCTTTGACAGATCCCACTCTCCTGTGTTGTGCCTTCAAAAAGCACAGGATATATTTATTCAGTCGAAGAGAGCCAGAGGAGCCTGAAGATGCAACTAAAGGAAGAGATGTGTTCAATGAAAAGCCACCTGCTGATGAACTTTTGGCAGTATCGGATATTGGAAAGTCAGTTACAACATCACTTCCTGACAATGTGATTCTACACACCACTATGGGTGATATTCACATGAAATTATACCCAGAGGAATGTCCAAAAACTGTGGAGAATTTCACTACTCACTGCCGAAATGGCTACTATGACAATCTTATTTTTCATAGGGTCATCAAAGGCTTCATGATACAAACAGGAGATCCTTTAGGAGATGGCACTGGTGGGCAGTCTATTTGGGGGAGAGAATTTGAGGATGAATTTCATAAAAGTTTGAGGCATGATAGGCCTTTCACAGTATCAATGGCAAATGCGGGCCAAAATACAAATGGTTCTCAGTTCTTTATAACCACAGTGGCTACTCCATGGTTGGACAACAAGCACACTGTATTTGGTAGAGTTGCCAAGGGAATGGATGTTGTACAGGCTATAGAAAAAGTGAAGACAGACAGGACAGATAAGCCACATCAAGATGTTAAAATTCTAAACGTAACTGTACCAAAGTCTTGA
Predicted protein sequences of Glyma12g30780
>Glyma12g30780.1   sequence type=predicted peptide   gene model=Glyma12g30780   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTEEHENGANASEEEQVIGPGPAPRARPKRPLQFEHAYLDALPSANMYEKSYMHRDVVTHVAVSAAEFFITGSADGHLKFWKKRPIGIEFAKHFRSHLGPIEGLAVSIDGLLCCTISNDRSVKIYDVVNFDMMVMIRLPYVPGAVEWVYKQGDVKARLAISDRNSSFVHIYDARAGTNDPIISKEIHMGPIKVMKYNPVCDSVLSADAKGIIEYWSPATLQFPENVVDFKLKSDTNLFEIAKCKTSVSAIEVSPDGKQFSITSPDRRIRVFWFSTGKLRRVYDESLEVAQDLQRSDAPLYRLEAIDFGRRMAVEKEIEKTESALLPNAVFDESSNFLIYATLLGIKIVNLHTNKVARILGKVENNDRFLRIALYQGDRNSKKVRKIPSAAANANESKEPLTDPTLLCCAFKKHRIYLFSRREPEEPEDATKGRDVFNEKPPADELLAVSDIGKSVTTSLPDNVILHTTMGDIHMKLYPEECPKTVENFTTHCRNGYYDNLIFHRVIKGFMIQTGDPLGDGTGGQSIWGREFEDEFHKSLRHDRPFTVSMANAGQNTNGSQFFITTVATPWLDNKHTVFGRVAKGMDVVQAIEKVKTDRTDKPHQDVKILNVTVPKS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo