SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma12g30010): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma12g30010): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma12g30010

Feature Type:gene_model
Chromosome:Gm12
Start:33524409
stop:33524936
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G43090AT Annotation by Michelle Graham. TAIR10: Aconitase/3-isopropylmalate dehydratase protein | chr2:17918957-17919712 FORWARD LENGTH=251 SoyBaseE_val: 3.00E-46ISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006972GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic response SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009098GO-bp Annotation by Michelle Graham. GO Biological Process: leucine biosynthetic process SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009316GO-cc Annotation by Michelle Graham. GO Cellular Compartment: 3-isopropylmalate dehydratase complex SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009536GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0003861GO-mf Annotation by Michelle Graham. GO Molecular Function: 3-isopropylmalate dehydratase activity SoyBaseN/AISS
GO:0016836GO-mf Annotation by Michelle Graham. GO Molecular Function: hydro-lyase activity SoyBaseN/AISS
PTHR11670Panther ACONITASE JGI ISS
PTHR11670:SF2Panther ACONITASE-RELATED JGI ISS
PF00694PFAM Aconitase C-terminal domain JGI ISS
UniRef100_B7ZGN7UniRef Annotation by Michelle Graham. Most informative UniRef hit: 3-isopropylmalate dehydratase (Fragment) n=1 Tax=Laminaria digitata RepID=B7ZGN7_9PHAE SoyBaseE_val: 1.00E-44ISS
UniRef100_I1LTL7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LTL7_SOYBN SoyBaseE_val: 6.00E-114ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g30010 not represented in the dataset

Glyma12g30010 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g176600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma12g30010.1   sequence type=CDS   gene model=Glyma12g30010   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCATTGTTCTCTGCTTCGGCAACCGTTCTTCCTCAGAACCTCGCATTCACTTCCTCCACCAACTTATTCCCCTCTCATAGTCACTCACTTTTACATCGCTTCCTTTCATTCTCAACTCCCAAATCATCAAACCCTCGCAACTGCATTGCGATCTCTCTCCAAACCACACACGTTCAATCTGGCGTGTGCACCTCCTTCTACAACCTTTGTTATGTCGTCAACGACAACATCGACACCAACCAGATCATTCCCGCAGAGTACCTCACCCTTGTCCCTTCGAAGCCCGACGAGTACGAGAAGTTTGGCTCCTACACCCTCACTGGCATCCCTGCCACCTACCCCATGCGCTTCGTCGACCTCGGTGAGGCCAATACCAAGTATGCCATTGTCATTGGCAGTTCCAACTTTGGTCGCGGCTCCTCTCATGAGCATGCCCCTGTGGCGCTGAGCGCCTCCAGCGCCACCATAGTGTTCGCGGAGTCGTACGCTAGGATCTTCTTTCGGAACTCCATGGCCACCAGCTAG

>Glyma12g30010.1   sequence type=predicted peptide   gene model=Glyma12g30010   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALFSASATVLPQNLAFTSSTNLFPSHSHSLLHRFLSFSTPKSSNPRNCIAISLQTTHVQSGVCTSFYNLCYVVNDNIDTNQIIPAEYLTLVPSKPDEYEKFGSYTLTGIPATYPMRFVDLGEANTKYAIVIGSSNFGRGSSHEHAPVALSASSATIVFAESYARIFFRNSMATS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo