Glyma12g30010 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma12g30010): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma12g30010): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma12g30010

Feature Type:	gene_model
Chromosome:	Gm12
Start:	33524409
stop:	33524936
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma12g30010

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G43090	AT	Annotation by Michelle Graham. TAIR10: Aconitase/3-isopropylmalate dehydratase protein \| chr2:17918957-17919712 FORWARD LENGTH=251	SoyBase	E_val: 3.00E-46	ISS
GO:0006096	GO-bp	Annotation by Michelle Graham. GO Biological Process: glycolysis	SoyBase	N/A	ISS
GO:0006833	GO-bp	Annotation by Michelle Graham. GO Biological Process: water transport	SoyBase	N/A	ISS
GO:0006972	GO-bp	Annotation by Michelle Graham. GO Biological Process: hyperosmotic response	SoyBase	N/A	ISS
GO:0007030	GO-bp	Annotation by Michelle Graham. GO Biological Process: Golgi organization	SoyBase	N/A	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0009098	GO-bp	Annotation by Michelle Graham. GO Biological Process: leucine biosynthetic process	SoyBase	N/A	ISS
GO:0009266	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0009316	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: 3-isopropylmalate dehydratase complex	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009536	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plastid	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0003861	GO-mf	Annotation by Michelle Graham. GO Molecular Function: 3-isopropylmalate dehydratase activity	SoyBase	N/A	ISS
GO:0016836	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydro-lyase activity	SoyBase	N/A	ISS
PTHR11670	Panther	ACONITASE	JGI		ISS
PTHR11670:SF2	Panther	ACONITASE-RELATED	JGI		ISS
PF00694	PFAM	Aconitase C-terminal domain	JGI		ISS
UniRef100_B7ZGN7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: 3-isopropylmalate dehydratase (Fragment) n=1 Tax=Laminaria digitata RepID=B7ZGN7_9PHAE	SoyBase	E_val: 1.00E-44	ISS
UniRef100_I1LTL7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LTL7_SOYBN	SoyBase	E_val: 6.00E-114	ISS

Expression Patterns of Glyma12g30010

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g30010 not represented in the dataset	Glyma12g30010 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma12g30010 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.12g176600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma12g30010

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma12g30010

Limit To All Plant Sequences

>Glyma12g30010.1   sequence type=CDS   gene model=Glyma12g30010   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCATTGTTCTCTGCTTCGGCAACCGTTCTTCCTCAGAACCTCGCATTCACTTCCTCCACCAACTTATTCCCCTCTCATAGTCACTCACTTTTACATCGCTTCCTTTCATTCTCAACTCCCAAATCATCAAACCCTCGCAACTGCATTGCGATCTCTCTCCAAACCACACACGTTCAATCTGGCGTGTGCACCTCCTTCTACAACCTTTGTTATGTCGTCAACGACAACATCGACACCAACCAGATCATTCCCGCAGAGTACCTCACCCTTGTCCCTTCGAAGCCCGACGAGTACGAGAAGTTTGGCTCCTACACCCTCACTGGCATCCCTGCCACCTACCCCATGCGCTTCGTCGACCTCGGTGAGGCCAATACCAAGTATGCCATTGTCATTGGCAGTTCCAACTTTGGTCGCGGCTCCTCTCATGAGCATGCCCCTGTGGCGCTGAGCGCCTCCAGCGCCACCATAGTGTTCGCGGAGTCGTACGCTAGGATCTTCTTTCGGAACTCCATGGCCACCAGCTAG

Predicted protein sequences of Glyma12g30010

Limit To All Plant Sequences

>Glyma12g30010.1   sequence type=predicted peptide   gene model=Glyma12g30010   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALFSASATVLPQNLAFTSSTNLFPSHSHSLLHRFLSFSTPKSSNPRNCIAISLQTTHVQSGVCTSFYNLCYVVNDNIDTNQIIPAEYLTLVPSKPDEYEKFGSYTLTGIPATYPMRFVDLGEANTKYAIVIGSSNFGRGSSHEHAPVALSASSATIVFAESYARIFFRNSMATS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain