Report for Sequence Feature Glyma12g26190
Feature Type: gene_model
Chromosome: Gm12
Start: 29514536
stop: 29517365
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma12g26190
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G53950 AT
Annotation by Michelle Graham. TAIR10: NAC (No Apical Meristem) domain transcriptional regulator superfamily protein | chr5:21901966-21903795 REVERSE LENGTH=375
SoyBase E_val: 1.00E-110 ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0007275 GO-bp
Annotation by Michelle Graham. GO Biological Process: multicellular organismal development
SoyBase N/A ISS
GO:0009965 GO-bp
Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis
SoyBase N/A ISS
GO:0010072 GO-bp
Annotation by Michelle Graham. GO Biological Process: primary shoot apical meristem specification
SoyBase N/A ISS
GO:0010160 GO-bp
Annotation by Michelle Graham. GO Biological Process: formation of organ boundary
SoyBase N/A ISS
GO:0010223 GO-bp
Annotation by Michelle Graham. GO Biological Process: secondary shoot formation
SoyBase N/A ISS
GO:0048366 GO-bp
Annotation by Michelle Graham. GO Biological Process: leaf development
SoyBase N/A ISS
GO:0048504 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of timing of organ formation
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003677 GO-mf
Annotation by Michelle Graham. GO Molecular Function: DNA binding
SoyBase N/A ISS
GO:0003700 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity
SoyBase N/A ISS
PF02365 PFAM
No apical meristem (NAM) protein
JGI ISS
UniRef100_B8XS03 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: NO APICAL MERISTEM2 n=1 Tax=Pisum sativum RepID=B8XS03_PEA
SoyBase E_val: 4.00E-151 ISS
UniRef100_I1LT65 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LT65_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma12g26190
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Gene model name correspondences to Glyma12g26190 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.12g161700 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma12g26190
Coding sequences of Glyma12g26190
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma12g26190.1 sequence type=CDS gene model=Glyma12g26190 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGATAGCTACTACCATCAACACCACAACCCTCACTTTGACAACAACAATGAACCACATTTACCTCCTGGCTTCAGATTCCACCCCACAGATGAAGAACTCATCACATACTACCTCCTCAAGAAGGTTCTAGATAGCTCCTTCACTGGCCGAGCCATAGTTGAAGTCGACCTCAACAAGTGCGAGCCATGGGAACTTCCTGAGAAAGCAAAGATGGGTGAGAAGGAATGGTACTTCTATAGCCTTCGTGACCGAAAGTACCCAACTGGGTTACGCACAAATAGAGCCACTGAAGCTGGTTATTGGAAAGCCACTGGAAAAGACAGAGAGATTTACAGCTCCAAAACTTGCTCACTCGTTGGCATGAAGAAAACCTTGGTTTTCTATAGAGGAAGGGCTCCAAAGGGTGAAAAGAGCAACTGGGTCATGCACGAGTATCGCTTAGAAGGCAAATTCGCTTACCACTATCTCTCTAGGAGCTCCAAGGAAGAGTGGGTGATCTCACGTGTGTTTCAGAAGAACACCACCGGCGGTGGCTCCACCGTGTCATCCGCCTCCGCCGCCACCACCGGTGGTAGTTCTAAGAAAACAAGAATGACCACATCAAACAATAGCAGCAACATGAGCCTCTGCCCCGAACCGGGTTCACCCTCTTCCATATACCTTCCGCCGCTTCTAGAATCTTCTCCTTACGCCGCGGCTGCGGCAACATTCAACGACCGCGAAAGATGCTCCTTCGACAGCGCCGCCAACAACAACCAAAGGGAGCACGTGTCCTGTTTCTCCACCATCTCCGGCGCCGCCTTCGACCACCTCGTTCCGTCGCCGGAGCCTCCGCTCGACCCTTCCGCTCGCTTTCATCGTAACAACAACAACAACGTCGGTGTCGGAATCTCCACCTTCCCGTGCCTCAGATCCTTGCACGACAACCTTAACCTTCCCTTCTTTTTCTCTCCAACGGGCCACATCAGCAGTGCTGAAGTGGCATCATTTGGTGCCGTTGGCAACTGGACGGCGGCACCGGAAGAGCACAGGATGGCTGACAGTGGCTCCGGCATGACGATTGTACCGTCCGAGTTGGATTGCATGTGGGACTATTGA
Predicted protein sequences of Glyma12g26190
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma12g26190.1 sequence type=predicted peptide gene model=Glyma12g26190 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MDSYYHQHHNPHFDNNNEPHLPPGFRFHPTDEELITYYLLKKVLDSSFTGRAIVEVDLNKCEPWELPEKAKMGEKEWYFYSLRDRKYPTGLRTNRATEAGYWKATGKDREIYSSKTCSLVGMKKTLVFYRGRAPKGEKSNWVMHEYRLEGKFAYHYLSRSSKEEWVISRVFQKNTTGGGSTVSSASAATTGGSSKKTRMTTSNNSSNMSLCPEPGSPSSIYLPPLLESSPYAAAAATFNDRERCSFDSAANNNQREHVSCFSTISGAAFDHLVPSPEPPLDPSARFHRNNNNNVGVGISTFPCLRSLHDNLNLPFFFSPTGHISSAEVASFGAVGNWTAAPEEHRMADSGSGMTIVPSELDCMWDY*