Glyma12g25485 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma12g25485

Feature Type:	gene_model
Chromosome:	Gm12
Start:	28418154
stop:	28419243
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma12g25485

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
UniRef100_I1LQN8	UniRef	Annotation by Michelle Graham. Best UniRef hit: ATP-dependent zinc metalloprotease FtsH 13 n=1 Tax=Glycine max RepID=I1LQN8_SOYBN	SoyBase	E_val: 2.00E-21	ISS
UniRef100_I1LQN8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: ATP-dependent zinc metalloprotease FtsH 13 n=1 Tax=Glycine max RepID=I1LQN8_SOYBN	SoyBase	E_val: 2.00E-21	ISS

Expression Patterns of Glyma12g25485

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g25485 not represented in the dataset	Glyma12g25485 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma12g25485 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.12g156100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma12g25485

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma12g25485

Limit To All Plant Sequences

>Glyma12g25485.1   sequence type=CDS   gene model=Glyma12g25485   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCCTCTCCCTTCCTTGGAGACATCCTACTAAGGAAGACGTCGACCTCAATGTCTTCTACCAGAGCTCGTAGTAATGGCTTCATTTCCAATTTGCCTGATTGTAAATTTGCTGCAACAAACCCTAAGATTCGCCAATTTTTTTGCAATGAAGCTCCGAAGAAGAATTATAAGAACTTCTATCCCAAGGAAAAGAAGGAAGTTCCGAAGAGGAATGACAAGAAACATGAGTACAAAGGATGTTGTAAGTTTGACCAATTTTTTCCAAAACACCCGTGGAATATCAGTAGAAGAGAAGCGCCATATATTTTTGCCTACATAATAAGCATGATTTTTGCAAGGAAATATTTAAATGGCTTTTTACTTAGCAGAGATGCCAATTTCCTCGTATGTTTCAATTATTTATTCTAA

Predicted protein sequences of Glyma12g25485

Limit To All Plant Sequences

>Glyma12g25485.1   sequence type=predicted peptide   gene model=Glyma12g25485   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSSPFLGDILLRKTSTSMSSTRARSNGFISNLPDCKFAATNPKIRQFFCNEAPKKNYKNFYPKEKKEVPKRNDKKHEYKGCCKFDQFFPKHPWNISRREAPYIFAYIISMIFARKYLNGFLLSRDANFLVCFNYLF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain