SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma12g24991

Feature Type:gene_model
Chromosome:Gm12
Start:27901272
stop:27902299
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma12g24991
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
ATMG00730AT Annotation by Michelle Graham. TAIR10: cytochrome c oxidase subunit 3 | chrM:218280-219077 FORWARD LENGTH=265 SoyBaseE_val: 2.00E-162ISS
GO:0022904GO-bp Annotation by Michelle Graham. GO Biological Process: respiratory electron transport chain SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005751GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial respiratory chain complex IV SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0004129GO-mf Annotation by Michelle Graham. GO Molecular Function: cytochrome-c oxidase activity SoyBaseN/AISS
GO:0015002GO-mf Annotation by Michelle Graham. GO Molecular Function: heme-copper terminal oxidase activity SoyBaseN/AISS
KOG4664 KOG Cytochrome oxidase subunit III and related proteins JGI ISS
PTHR11403Panther CYTOCHROME C OXIDASE POLYPEPTIDE III JGI ISS
PF00510PFAM Cytochrome c oxidase subunit III JGI ISS
UniRef100_G7I8U0UniRef Annotation by Michelle Graham. Best UniRef hit: Cytochrome c oxidase subunit 3 n=1 Tax=Medicago truncatula RepID=G7I8U0_MEDTR SoyBaseE_val: 0ISS
UniRef100_G7I8U0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cytochrome c oxidase subunit 3 n=1 Tax=Medicago truncatula RepID=G7I8U0_MEDTR SoyBaseE_val: 0ISS

Expression Patterns of Glyma12g24991
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g24991 not represented in the dataset
Glyma12g24991 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma12g24991 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma12g24991
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma12g24991
>Glyma12g24991.1   sequence type=CDS   gene model=Glyma12g24991   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATTGAATCTCAGAGGCATTCTTATCATTTGGTAGATCCAAGTCCATGGCCTATTTCGGGTTCACTCGGAGCTTTGGCAACCACCGTAGGAGGTGTGATGTACATGCACTCATTTCAAGGGGGTGCAACACTTCTCAGTTTGGGCCTAATATTTATCCTATATACCATGTTTGTATGGTGGCGCGATGTTCTACGTGAATCCACGTTGGAAGGACATCATACCAAAGTCGTACAATTAGGACCTCGATATGGTTCTATTCCGTTCATCGTATCGGAGGTTATGTTCCTTTTTGCTTTTTTTCGGGCTTCTTCTCATTCTTCTTTGGCACCTACGGTAGAGATCGGAGGTATTTGGCCCCCTTTAGGGATTTGGGTTTTAGATCCTCGGGAAATCCCTTTTCTTAATACCCCTATTCTCCTTTCATCCGGAGCAGCCGTAACTTGGGCTCATCATGCTATACTCGCGGGGAAGGAAAAACGAGCAGTTTACGCTTTAGTAGCTACCGTTTCACTGGCTCTAGTATTCACTGGCTTTCAAGGAATGGAATATTATCAAGCACCCTTCACTATTTCGGATAGTATTTATGGTTCTACCTTTTTCTTAGCAACTGGCTTTCATGGTTTTCATGTGATTATAGGTACTCTTTTCTTGATCATATGTGGTATTCGCCAATATCTTGGTCATCTGACCAAGGAGCATCACGTTGGCTTTGAAGCAGCTGCATGGTACTGGCATTTTGTAGACGTGGAACGAAACAGTGGATTGAGGAATGAAAGCTCGAAGACAAAGAGAACCGGGCTTTTTCTTTATAGGTATAGATTGCTGAGATGGTTCTGGAACTCACGGAAAGAGGCTTTTAAGGGGTGCGCCCTTAACCCGATTCCGGGTGAGTTCTGGAAACGACTAATTTGGTACAAAAACAGGCTCTATGGTTTGTTTTTGATCTATCGCTATCTCCAAAAAAAAGAGAAATGA
Predicted protein sequences of Glyma12g24991
>Glyma12g24991.1   sequence type=predicted peptide   gene model=Glyma12g24991   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MIESQRHSYHLVDPSPWPISGSLGALATTVGGVMYMHSFQGGATLLSLGLIFILYTMFVWWRDVLRESTLEGHHTKVVQLGPRYGSIPFIVSEVMFLFAFFRASSHSSLAPTVEIGGIWPPLGIWVLDPREIPFLNTPILLSSGAAVTWAHHAILAGKEKRAVYALVATVSLALVFTGFQGMEYYQAPFTISDSIYGSTFFLATGFHGFHVIIGTLFLIICGIRQYLGHLTKEHHVGFEAAAWYWHFVDVERNSGLRNESSKTKRTGLFLYRYRLLRWFWNSRKEAFKGCALNPIPGEFWKRLIWYKNRLYGLFLIYRYLQKKEK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo