SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma12g24190

Feature Type:gene_model
Chromosome:Gm12
Start:26922835
stop:26923995
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma12g24190
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G01140AT Annotation by Michelle Graham. TAIR10: Aldolase superfamily protein | chr2:95006-96491 REVERSE LENGTH=391 SoyBaseE_val: 0ISS
GO:0006007GO-bp Annotation by Michelle Graham. GO Biological Process: glucose catabolic process SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009536GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0010287GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastoglobule SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004332GO-mf Annotation by Michelle Graham. GO Molecular Function: fructose-bisphosphate aldolase activity SoyBaseN/AISS
KOG1557 KOG Fructose-biphosphate aldolase JGI ISS
PTHR11627Panther FRUCTOSE-BISPHOSPHATE ALDOLASE JGI ISS
PF00274PFAM Fructose-bisphosphate aldolase class-I JGI ISS
UniRef100_I1LT45UniRef Annotation by Michelle Graham. Most informative UniRef hit: Fructose-bisphosphate aldolase n=1 Tax=Glycine max RepID=I1LT45_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1LT45UniRef Annotation by Michelle Graham. Best UniRef hit: Fructose-bisphosphate aldolase n=1 Tax=Glycine max RepID=I1LT45_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma12g24190
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma12g24190 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g153000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma12g24190
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma12g24190
>Glyma12g24190.1   sequence type=CDS   gene model=Glyma12g24190   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGTCTGCAAAGCTCAACACCTTGTCTTCCCAGTGGATCGCCCACAATTCCTTCTCTCCTCGCCGTGGATCCTCTTCTCGCCGAGTCTCTCTTCCGATCCGCGCTTCTTCTTACCAACACGAACTCGTCCAAACCGCCAAATCTATTGCATCTCCCAGTCGTGGAATTCTTGCAATTGATGAATCAAATGCCACATGTGGGAAGCGTTTAGCATCCATTGGATTGGACAATACTGAGGTGAATCGCCAGGCCTATAGGCAACTTCTGCTCACCACACCTGGCCTTGGTGAATACATCTCTGGTGCAATTCTTTTTGAAGAAACCCTTTACCAGTCGACAACAGATGGAAATAAATTTGTGGATTGCCTCCGCGATCAGAACATTGTGCCCGACATCAAAGTTGATAAGGGTCTGGTCCCTCTGCCAGGGTCAAACAATGAGTCTTGGTCTGCTGAATACTACAAGCAAGGTGCTCGATTTGCCAAGTGGAGGACAGTTGTTAGCATTCCATGTGGTCCTTCTGCATTAGCTGTCAAGGAAGCAGCGTGGGGGCTTGCACGTTATGCTGCTATCTCTCAGGACAATGGTCTTGTGCCAATCGTAGAGCCTGAAATTCTTCTTGATGGAGATCACCCAATTGAGAGGACACTGGAAGTGGCCGAGAAGGTCTGGTCAGAAGTCTTCTTCTATTTGGCTGAAAACAATGTCCTTTTTGAGGGAATTTTGCTCAAACCCAGCATGGTTACACCTGGGGCTGAACACACGGAAAAGGCTTCTCCGGAAACCATTGCCAAATATACTCTAACCATGCTTAGAAGAAGAGTTCCTCCTGCTCTCCCTGGAATCATGTTTTTGTCTGGTGGACAATCCGAAGTGGAAGCAACACTAAATCTAAATGCCATGAACCAAAGTCCCAACCCATGGCATGTTTCTTTCTCATATGCACGGGCTCTTCAGAACACTGTGCTTAAGACATGGCAAGGACACCCTGAGAATGTGGAAGCTGCTCAAAAGTCCCTTTTGGTGCGCGCTAAAGCAAACTCCTTGGCTCAACTTGGAAGATACTCTGCTGAGGGTGAGAGTGAAGAGGCCAAGAAGGGAATGTTTGTCAAGGGCTATACCTACTAA
Predicted protein sequences of Glyma12g24190
>Glyma12g24190.1   sequence type=predicted peptide   gene model=Glyma12g24190   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASAKLNTLSSQWIAHNSFSPRRGSSSRRVSLPIRASSYQHELVQTAKSIASPSRGILAIDESNATCGKRLASIGLDNTEVNRQAYRQLLLTTPGLGEYISGAILFEETLYQSTTDGNKFVDCLRDQNIVPDIKVDKGLVPLPGSNNESWSAEYYKQGARFAKWRTVVSIPCGPSALAVKEAAWGLARYAAISQDNGLVPIVEPEILLDGDHPIERTLEVAEKVWSEVFFYLAENNVLFEGILLKPSMVTPGAEHTEKASPETIAKYTLTMLRRRVPPALPGIMFLSGGQSEVEATLNLNAMNQSPNPWHVSFSYARALQNTVLKTWQGHPENVEAAQKSLLVRAKANSLAQLGRYSAEGESEEAKKGMFVKGYTY*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo