Glyma12g23350 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma12g23350

Feature Type:	gene_model
Chromosome:	Gm12
Start:	25746763
stop:	25751557
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma12g23350

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G53000	AT	Annotation by Michelle Graham. TAIR10: Nucleotide-diphospho-sugar transferases superfamily protein \| chr1:19745330-19747133 REVERSE LENGTH=290	SoyBase	E_val: 2.00E-174	ISS
GO:0009103	GO-bp	Annotation by Michelle Graham. GO Biological Process: lipopolysaccharide biosynthetic process	SoyBase	N/A	ISS
GO:0009555	GO-bp	Annotation by Michelle Graham. GO Biological Process: pollen development	SoyBase	N/A	ISS
GO:0009860	GO-bp	Annotation by Michelle Graham. GO Biological Process: pollen tube growth	SoyBase	N/A	ISS
GO:0019243	GO-bp	Annotation by Michelle Graham. GO Biological Process: methylglyoxal catabolic process to D-lactate	SoyBase	N/A	ISS
GO:0033468	GO-bp	Annotation by Michelle Graham. GO Biological Process: CMP-keto-3-deoxy-D-manno-octulosonic acid biosynthetic process	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0031307	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to mitochondrial outer membrane	SoyBase	N/A	ISS
GO:0008690	GO-mf	Annotation by Michelle Graham. GO Molecular Function: 3-deoxy-manno-octulosonate cytidylyltransferase activity	SoyBase	N/A	ISS
GO:0016779	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotidyltransferase activity	SoyBase	N/A	ISS
PTHR21485	Panther	CMP-N-ACETYLNEURAMINIC ACID SYNTHASE	JGI		ISS
PTHR21485:SF4	Panther	CMP-2-KETO-3-DEOCTULOSONATE (CMP-KDO) CYTIDYLTRANSFERASE	JGI		ISS
PF02348	PFAM	Cytidylyltransferase	JGI		ISS
UniRef100_B9RU62	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Cmp-2-keto-3-deoctulosonate (Cmp-kdo) cytidyltransferase, putative n=1 Tax=Ricinus communis RepID=B9RU62_RICCO	SoyBase	E_val: 0	ISS
UniRef100_I1LT34	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LT34_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma12g23350

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma12g23350 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.12g151500	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma12g23350

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma12g23350

Limit To All Plant Sequences

>Glyma12g23350.1   sequence type=CDS   gene model=Glyma12g23350   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAATTTGTTCCTCACTTTCATCGTCATCGTCATCGTCTTCTTCTTCTACATCGTCCTTTGGTTCCTCGAGCACCGCGAAGGCGTGGATCATCCATGGCATTGTGGCCGGAGTGGCGATTGCTGCGGCGGTGGGTGCACGCGCTTACATGACTCGATTCAGCAAGTTTCGGAGCCGGGTCGTGGGCATCATACCCGCCCGATTCGCTTCCTCGCGCTTCCAGGGAAAGCCTCTCGTTCAAATCCTTGGCAAGCCCATGATCCAGAGAACATGGGAAAGGGCAAAGCTGGCAGCTACATTGGATCATATTGTTGTGGCAACTGATGATGAAAAGATTGCTGATTGCTGTCGACAATTTGGAGCTGATGTTATAATGACATCAGAATCTTGCAGAAATGGTACTGAGCGCTGCAATGAAGCCCTACAGAAGCTTGGGAAAAAATATGATATTGTTGTCAACATTCAGGGTGATGAGCCACTTATTGAACCTGAGATAATAGATGGTGTTGTGAAAGCTTTGCAGGCAGCTCCTGATGCAGTGTTCAGCACTGCAGTCACATCTTTAAAGCCTGAAGATGCACATGATCCAAATAGAGTGAAATGTGTGGTAGATAATCGTGGTTATGCCATTTATTTTTCACGAGGATTAATCCCATTCAACAAGTCAGGAATGGTCAATCAACAGTTCCCGTATTTGCTTCATCTTGGGATTCAGAGCTACGATGCAAAGTTTCTGAATATATACCCTGATCTTCAACCTACTCCGTTGCAACTCGAGGAGGATTTGGAGCAGCTTAAAGTCCTTGAGAATGGCTACAAGATGAAGGTGATAAAAGTTGATCATGAGGCTCATGGTGTTGACACTCCTGAAGATGTTGGAAAGATAGAATCTCTAATGCGTGAGAGGAACTTGTCTTGA

Predicted protein sequences of Glyma12g23350

Limit To All Plant Sequences

>Glyma12g23350.1   sequence type=predicted peptide   gene model=Glyma12g23350   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAICSSLSSSSSSSSSSTSSFGSSSTAKAWIIHGIVAGVAIAAAVGARAYMTRFSKFRSRVVGIIPARFASSRFQGKPLVQILGKPMIQRTWERAKLAATLDHIVVATDDEKIADCCRQFGADVIMTSESCRNGTERCNEALQKLGKKYDIVVNIQGDEPLIEPEIIDGVVKALQAAPDAVFSTAVTSLKPEDAHDPNRVKCVVDNRGYAIYFSRGLIPFNKSGMVNQQFPYLLHLGIQSYDAKFLNIYPDLQPTPLQLEEDLEQLKVLENGYKMKVIKVDHEAHGVDTPEDVGKIESLMRERNLS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain