SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma12g22340

Feature Type:gene_model
Chromosome:Gm12
Start:24320938
stop:24332373
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma12g22340
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G35590AT Annotation by Michelle Graham. TAIR10: proteasome alpha subunit A1 | chr5:13765417-13767768 REVERSE LENGTH=246 SoyBaseE_val: 1.00E-168ISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0010043GO-bp Annotation by Michelle Graham. GO Biological Process: response to zinc ion SoyBaseN/AISS
GO:0051603GO-bp Annotation by Michelle Graham. GO Biological Process: proteolysis involved in cellular protein catabolic process SoyBaseN/AISS
GO:0000502GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proteasome complex SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005839GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proteasome core complex SoyBaseN/AISS
GO:0019773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proteasome core complex, alpha-subunit complex SoyBaseN/AISS
GO:0004175GO-mf Annotation by Michelle Graham. GO Molecular Function: endopeptidase activity SoyBaseN/AISS
GO:0004298GO-mf Annotation by Michelle Graham. GO Molecular Function: threonine-type endopeptidase activity SoyBaseN/AISS
GO:0008233GO-mf Annotation by Michelle Graham. GO Molecular Function: peptidase activity SoyBaseN/AISS
KOG0182 KOG 20S proteasome, regulatory subunit alpha type PSMA6/SCL1 JGI ISS
PTHR11599Panther PROTEASOME SUBUNIT ALPHA/BETA JGI ISS
PTHR11599:SF11Panther PROTEASOME BETA/DELTA SUBUNIT JGI ISS
PF00227PFAM Proteasome subunit JGI ISS
PF10584PFAM Proteasome subunit A N-terminal signature JGI ISS
UniRef100_I1LSZ7UniRef Annotation by Michelle Graham. Best UniRef hit: Proteasome subunit alpha type n=2 Tax=Glycine max RepID=I1LSZ7_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1LSZ7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Proteasome subunit alpha type n=2 Tax=Glycine max RepID=I1LSZ7_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma12g22340
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma12g22340
ParalogEvidenceComments
Glyma06g39710 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma12g22340 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g147200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma12g22340
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma12g22340
>Glyma12g22340.1   sequence type=CDS   gene model=Glyma12g22340   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGTCGAGGAAGTGGAGGTGGATACGATCGTCACATCACTATTTTCTCCCCTGAAGGACGTCTCTTCCAAGTCGAGTATGCTTTCAAGGCTGTTAAGGCCGCAGGAATCACCTCAATTGGTGTCCGAGGAAAGGATTCGATTTGTGTTGTTACTCAGAAGAAGGTTCCGGATAAGCTTTTGGACAACACAAGTGTTACACACCTCTTTCCCATCACCAAGTACCTTGGTTTATTGGCTACTGGCATGACAGCTGATGCTAGGACACTGGTCCAACAAGCAAGAAATGAAGCAGCTGAGTTTCGCTTTACATATGGATATGAAATGCCTGTAGATGTATTAGCTAAATGGATTGCAGACAAATCACAAGTCTATACTCAACATGCTTATATGAGACCACTTGGAGTAGTTGCCATGGTTTTGGGTATTGATGATGAATATGGACCTCAGCTTTACAAATGTGATCCAGCTGGTCATTACTTTGGTCACAAGGCAACAAGTGCTGGATTGAAGGACCAAGAGGCAATTAATTTCTTGGAAAAGAAGATGAAGAATGACCCTTCATTTACATATGAGGAGACAGTTCAGACTGCCATTTCTGCCCTGCAATCAGTTCTTCAGGAGGATTTTAAGGCCACTGAGATTGAGGTTGGAGTGGTGCGGAAAGAAAATCCAGAATTCAGAGTTTTAACCACCGAGGAAATTGATGAGCACTTGACTGCAATAAGTGAGCGTGACTGA
Predicted protein sequences of Glyma12g22340
>Glyma12g22340.1   sequence type=predicted peptide   gene model=Glyma12g22340   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSRGSGGGYDRHITIFSPEGRLFQVEYAFKAVKAAGITSIGVRGKDSICVVTQKKVPDKLLDNTSVTHLFPITKYLGLLATGMTADARTLVQQARNEAAEFRFTYGYEMPVDVLAKWIADKSQVYTQHAYMRPLGVVAMVLGIDDEYGPQLYKCDPAGHYFGHKATSAGLKDQEAINFLEKKMKNDPSFTYEETVQTAISALQSVLQEDFKATEIEVGVVRKENPEFRVLTTEEIDEHLTAISERD*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo